- Research
- Open Access
Identification of the epigenetic reader CBX2 as a potential drug target in advanced prostate cancer
- Pier-Luc Clermont1, 2,
- Francesco Crea1, 3, 4,
- Yan Ting Chiang1, 3,
- Dong Lin1, 3,
- Amy Zhang1,
- James Z. L. Wang1,
- Abhijit Parolia1,
- Rebecca Wu1,
- Hui Xue1,
- Yuwei Wang1,
- Jiarui Ding5, 6,
- Kelsie L. Thu7,
- Wan L. Lam7,
- Sohrab P. Shah5, 6,
- Colin C. Collins3, 8,
- Yuzhuo Wang1, 3, 8 and
- Cheryl D. Helgason1, 9Email author
https://doi.org/10.1186/s13148-016-0182-9
© Clermont et al. 2016
- Received: 27 November 2015
- Accepted: 4 February 2016
- Published: 12 February 2016
Abstract
Background
While localized prostate cancer (PCa) can be effectively cured, metastatic disease inevitably progresses to a lethal state called castration-resistant prostate cancer (CRPC). Emerging evidence suggests that aberrant epigenetic repression by the polycomb group (PcG) complexes fuels PCa progression, providing novel therapeutic opportunities.
Results
In the search for potential epigenetic drivers of CRPC, we analyzed the molecular profile of PcG members in patient-derived xenografts and clinical samples. Overall, our results identify the PcG protein and methyl-lysine reader CBX2 as a potential therapeutic target in advanced PCa. We report that CBX2 was recurrently up-regulated in metastatic CRPC and that elevated CBX2 expression was correlated with poor clinical outcome in PCa cohorts. Furthermore, CBX2 depletion abrogated cell viability and induced caspase 3-mediated apoptosis in metastatic PCa cell lines. Mechanistically explaining this phenotype, microarray analysis in CBX2-depleted cells revealed that CBX2 controls the expression of many key regulators of cell proliferation and metastasis.
Conclusions
Taken together, this study provides the first evidence that CBX2 inhibition induces cancer cell death, positioning CBX2 as an attractive drug target in lethal CRPC.
Keywords
- Castration-resistant prostate cancer
- CBX2
- Epigenetics
- Metastatic prostate cancer
- Polycomb
Background
At present, prostate cancer (PCa) represents the most commonly diagnosed non-cutaneous malignancy in men [1]. While localized disease can be effectively treated with surgery or radiotherapy, metastatic PCa remains invariably fatal [2]. For the past 30 years, androgen-deprivation therapy (ADT) has been the standard care for disseminated PCa. However, all tumors eventually acquire resistance to ADT and relapse in a highly aggressive state called castration-resistant prostate cancer (CRPC) [3]. Despite the introduction of novel therapeutic agents for late-stage patients, CRPC remains an incurable malignancy and thus a better understanding of its molecular drivers is required to facilitate the development of novel treatment strategies [4, 5]. Over the past decade, mounting evidence has demonstrated that epigenetic alterations significantly contribute to PCa progression, suggesting that the PCa epigenome may harbor clinically relevant therapeutic targets [6].
Epigenetics refers to changes in transcriptional programs that cannot be attributed to modifications in DNA sequence [7]. Epigenetic changes result in cellular and physiological phenotypic trait variations in response to external or environmental factors that switch genes on and off. Epigenetic regulation influences gene expression by controlling access of the transcriptional machinery to distinct genomic regions [8]. During embryonic development, epigenetic mechanisms define gene expression programs which themselves specify differentiation into distinct tissues [9]. In human cancers, these epigenetic states become disrupted, thereby promoting disease initiation and progression by altering the expression of key oncogenes and tumor suppressors [10, 11]. Given the clinical approval of a growing number of epigenetic drugs, there is considerable value in identifying novel chromatin-regulating complexes driving disease progression [12].
Emerging evidence suggests that epigenetic dysregulation mediated by the polycomb group (PcG) family of transcriptional repressors plays a critical role during PCa progression [13]. Conserved throughout evolution, PcG proteins assemble in two main polycomb repressive complexes, PRC1 and PRC2 [14]. In the classical model, PRC2 trimethylates histone H3 at lysine 27 (H3K27me3) via the catalytic activity of EZH2, thereby triggering transcriptional silencing [15]. H3K27me3 can then be recognized by the N-terminal chromodomain of five CBX proteins (CBX2, 4, 6, 7, 8), which are members of PRC1 [16]. Upon binding H3K27me3, CBX proteins can recruit PRC1 to chromatin through protein-protein interactions. PRC1 recruitment further promotes transcriptional repression through various mechanisms such as histone H2A ubiquitination and chromatin compaction, some of which are known to play a role in PCa progression [17, 18]. In advanced PCa, EZH2 is overexpressed and pharmacological inhibition of PRC2 impairs tumorigenicity and metastatic ability [13, 19]. Moreover, the PRC1 member BMI1 promotes resistance to docetaxel, a drug used in CRPC treatment via modulation of key transcriptomic programs [20]. While the tumor-promoting roles of EZH2 and BMI1 have been well established, the functional implication of individual PcG members during PCa progression and their contribution to CRPC have yet to be evaluated.
Since CBX proteins bridge the activity of PRC2 and PRC1, they represent critical regulators of PcG-mediated silencing [21]. We have previously demonstrated that CBX2 expression was significantly up-regulated in aggressive tumors of many cancer types, including PCa [22]. These novel findings complement studies from CBX2-deficient animals demonstrating critical functions for CBX2 in cellular proliferation and differentiation [23, 24]. It has been shown that animal models lacking CBX2 display multi-organ hypocellularity as a result of a proliferative block. In mice, germline deletion of the CBX2 homolog M33 results in homeotic transformations and sexual defects [25, 26]. Strikingly, it was shown across multiple species that individuals with XY karyotype lacking CBX2 were unable to undergo development of the male urogenital system, implying a role in prostatic cell proliferation and differentiation [26, 27]. Taken together, these findings indicate that CBX2 may be functionally involved in aberrant PcG-mediated silencing thought to promote PCa progression and drug resistance.
With the aim of identifying new epigenetic targets, we analyzed the molecular profiles of PcG family members in patient-derived xenograft (PDX) models and clinical samples of advanced PCa. Using validated in vitro and in vivo models [28, 29], we demonstrate that the PRC1 member and epigenetic reader CBX2 is recurrently overexpressed in metastatic and androgen-independent PCa cells and that elevated CBX2 expression predicts poor clinical outcome. Furthermore, we show that CBX2 depletion induces PCa cell death and proliferation arrest by regulating the expression of a key subset of genes, suggesting that CBX2 may emerge as a novel therapeutic target for advanced PCa.
Results
CBX2 is overexpressed in aggressive PCa
CBX2 is overexpressed in metastatic PCa. a Establishment of the LTL313B/LTL313H PDX model of metastatic PCa; b Expression of core PcG family members in the LTL313H/LTL313B xenograft model; Results are based on a single microarray experiment; c Confirmation of CBX2 mRNA up-regulation in the LTL313H tumor line by qRT-PCR; d Confirmation of CBX2 protein up-regulation in the LTL313H tumor line by IHC (20x). Images are representative of multiple fields taken from 2 independent experiments; e Elevated CBX2 mRNA levels in metastatic PCa compared to non-metastatic samples in three independent patients
Microarray analysis was performed on RNA extracted from LTL313B and LTL313H to identify differential expression of PcG genes. This analysis demonstrated that the chromodomain-containing protein, and known regulator of male urogenital system development, CBX2, was the most highly up-regulated PcG transcript in LTL313H compared to LTL313B (Fig. 1b). To validate these results, we assessed CBX2 expression in both tumor lines using quantitative reverse transcription polymerase chain reaction (qRT-PCR), which confirmed that CBX2 expression was 3.2-fold higher in LTL313H compared to LTL313B (Fig. 1c, p < 0.0001, Student’s t test). Consistent with messenger RNA (mRNA) levels, CBX2 protein expression was undetectable in LTL313B while LTL313H showed strong CBX2 immunostaining, in line with a possible role in PCa dissemination (Fig. 1d, ×20).
To ensure that overexpression of CBX2 in metastatic PCa tissues was not solely a property of the LTL313B/LTL313H xenograft model, we assessed the expression of CBX2 in primary and metastatic tumors from PCa patients using the Oncomine database [30]. As observed in the xenografts, CBX2 expression was significantly higher in metastatic compared to non-metastatic tumors in three independent clinical cohorts (Fig. 1e, p ≤ 0.05, Student’s t test). Importantly, we could not find a single study in which CBX2 was significantly down-regulated in metastatic tissues. Thus, the CBX2 up-regulation observed in the LTL313B/LTL313H PDX model was also recapitulated in patient tumors.
Multivariate analysis of variance correlating CBX2 and clinicopathological features in primary PCa from MSKCC cohort
Factor | F value | p value | Significance |
---|---|---|---|
Age | 4.8235 | 0.030674 | * |
Extension | 1.9261 | 0.131084 | |
Gleason | 5.5086 | 0.021142 | * |
Nodal | 15.4775 | 0.000165 | *** |
Race | 0.7067 | 0.55053 | |
Sem Vesicle | 0.0262 | 0.871665 | |
SurgMargins | 0.0839 | 0.772712 | |
T stage | 0.5005 | 0.607944 |
Hormonal regulation of CBX2 expression
Hormonal regulation of CBX2. a Establishment of the LTL313B/LTL313BR patient-derived xenograft model of CRPC; b Assessment of CBX2 mRNA levels in the LTL313B/LTL313BR xenograft model by qRT-PCR; c IHC staining of CBX2 in the LTL313B and LTL313BR xenografts ×20. Images are representative of multiple fields taken from two independent experiments; d Levels of CBX2 mRNA in androgen-dependent (AD, n = 10) and androgen-independent (AI, n = 5) PDXs from the LTL; e Relative CBX2 expression in PCa cell lines compared to benign control (BPH1) assessed by qRT-PCR; f CBX2 mRNA levels in LNCaP cells cultured in charcoaled-stripped media in the presence or absence of DHT supplementation (10 nM)
As the first step to link CBX2 and CRPC pathogenesis, we quantified the expression of CBX2 in the LTL313B/LTL313BR xenograft model and observed that CBX2 expression was elevated in LTL313BR relative to LTL313B using qRT-PCR (Fig. 2b, p < 0.001, Student’s t test). Furthermore, immunohistochemical (IHC) staining revealed that CBX2 protein levels were undetectable in LTL313B while LTL313BR exhibited strong CBX2 nuclear staining (Fig. 2c). To confirm the results obtained in the 313B/BR model, we assessed the expression of CBX2 in a panel of PCa PDX models that were either androgen-dependent (n = 10) or androgen-independent (n = 5) available at the Living Tumor Laboratory. In line with the 313B/BR model, CBX2 expression was significantly higher in the androgen-independent PDX models (Fig. 2d, p < 0.05, Student’s t test), consistent with a role in castration-resistant disease.
To complement the observations made in PDX models, we conducted in vitro studies investigating the androgenic regulation of CBX2. First, we quantified the expression of CBX2 in LNCaP and C4-2 cell lines compared with benign prostate hyperplasia cells (BPH1). The isogenic LNCaP/C4-2 model was chosen for these studies since it represents a validated and clinically relevant model of PCa progression. LNCaP was originally derived from a lymph node metastasis. It was subsequently implanted into a castrated mouse, giving rise to a castrate-resistant cell line C4-2 following ADT [32]. Both LNCaP and C4-2 express AR, but only LNCaP exhibits androgen-responsive growth [32]. Moreover, C4-2 xenografts display higher tumor formation and produce more metastatic foci in vivo, consistent with the idea that androgen-independent cells are inherently more aggressive [28]. Androgen-independent C4-2 cells displayed CBX2 mRNA levels 41 times higher than BPH1 while androgen-dependent LNCaP exhibited a nine-fold up-regulation in CBX2 expression (Fig. 2e, p < 0.0001 for both, Student’s t test). Next, CBX2 expression was assessed in vitro using androgen-responsive LNCaP cells subjected to removal and addition of dihydrotestosterone (DHT), a potent AR agonist. In LNCaP cells, CBX2 mRNA levels significantly increased after 48 h of culture in androgen-depleted media, as assessed by qRT-PCR (Fig. 2f, p < 0.001, Student’s t test). Accordingly, this dramatic effect was not observed in cells supplemented with DHT, suggesting that a decrease in ligand-induced AR transactivation reversibly stimulates CBX2 expression.
Genomic alterations affecting the CBX2 locus in PCa
PCa dataset and journal | No. of patients | % Mut | % CNG | % CNL |
---|---|---|---|---|
MSKCC—Cancer Cell 2010 | 103 | 0 | 2 | 1 |
Michigan—Nature 2012 | 61 | 0 | 5 | 0 |
Broad/Cornell—Nat. Gen. 2012 | 109 | 0 | 0 | 0 |
Broad/Cornell—Cell 2013 | 56 | 0 | 0 | 4 |
Total | 329 | 0 | 2 | 1 |
CBX2 depletion induces cell death in advanced PCa cell lines
CBX2 depletion induces proliferation arrest and apoptosis in advanced PCa cell lines. a, b Confirmation of CBX2 mRNA knockdown in LNCaP and C4-2 cells by qPCR; c, d Confirmation of CBX2 protein knockdown in LNCaP and C4-2 cells; e, f MTT analysis of cell viability following CBX2 silencing in LNCaP and C4-2 cells; g, h Assessment of caspase 3–7 activity in LNCaP and C4-2 cells following CBX2 depletion
Morphology of LNCaP and C4-2 cells following CBX2 depletion (96 h post-siRNA treatment). Images are representative of multiple fields taken from three independent experiments (×20 for large image and ×40 for small image)
To quantify the extent of cell viability loss resulting from CBX2 depletion, we conducted 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) analysis on LNCaP and C4-2 cells treated with mock, non-targeting control, or CBX2-specific siRNA. MTT assay confirmed a significant reduction in cell viability following CBX2 knockdown in both cell lines (Fig. 3e, f, p < 0.0001, Student’s t test). More specifically, the proliferation arrest induced by CBX2 depletion started to appear 3 days after siRNA treatment and culminated in a dramatic decrease in cell viability after 5 days in both cell lines, thus confirming the microscopic observations. To explore the possibility that CBX2 might regulate apoptotic cell death, caspase 3/7 activity was analyzed in LNCaP and C4-2 cells treated with either control or CBX2-specific siRNA for 72 h. Notably, CBX2 depletion induced a 3.7- and 2.3-fold increase in caspase 3/7 activity in LNCaP and C4-2, respectively (Fig. 3g, h, p < 0.001, Student’s t test), suggesting that CBX2 is required for PCa cell survival. Taken together, these findings indicate that CBX2 is functionally involved in the regulation of PCa cell morphology, proliferation, and apoptosis.
Gene expression profiling of CBX2-depleted cells
Gene expression profiling of CBX2-regulated genes. a Experimental design of microarray analysis; b Validation of CBX2 silencing in samples subjected to microarray analysis; c Unsupervised hierarchical clustering of genes differentially expressed following CBX2 knockdown; d Differential expression of up-regulated CRGs confirmed by qRT-PCR in CBX2-depleted C4-2 cells; e Differential expression of down-regulated CRGs confirmed by qRT-PCR in CBX2-depleted C4-2 cells
After validating RNA quality and knockdown efficiency, we conducted microarray analysis using the Agilent platform. First, we conducted qRT-PCR and validated an 80 % inhibition of CBX2 expression in cells treated with CBX2-specific siRNA (Fig. 5b, p < 0.0001, Student’s t test). Using an unpaired t test with Benjamini-Hochberg correction, we identified 544 transcripts that were differentially expressed upon CBX2 silencing and were termed CBX2-regulated genes (CRGs, Fig. 5a). Among them, 232 were up-regulated and 312 were down-regulated (Fig. 5a). Unsupervised hierarchical clustering revealed that the up-regulated and down-regulated genes have distinct expression patterns which are extremely consistent across all replicates (Fig. 5c).
To ensure that the expression changes observed in the microarray profiling were reproducible, we first selected individual CRGs previously associated with cancer whose expression could be validated by qRT-PCR. Interestingly, a number of important regulators of cell proliferation and metastasis were significantly modulated after CBX2 depletion. Notably, ITGB8, DICER1, INPP5A, PIK3R1, and TIMP2 are key tumor suppressors that were among up-regulated CRGs following CBX2 knockdown. Significant up-regulation of these genes in CBX2-depleted cells was also validated using qRT-PCR (Fig. 5d, p ≤ 0.05 for all, Student’s t test). Conversely, the tumor-associated proteins MKI67, FOXM1, CENPF, TERT, and CEP55 were down-regulated following CBX2 silencing, which was also successfully confirmed by qRT-PCR (Fig. 5e, p ≤ 0.05 for all, Student’s t test). Thus, qRT-PCR replicated the transcriptomic changes detected through microarray analysis, providing another quality control to ensure the validity of the microarray results.
Biological properties of CBX2-regulated genes
Top diseases associated with CBX2-regulated genes (IPA analysis)
Rank | Category | p value |
---|---|---|
1 | Cancer | 5.86E-10–1.71E-02 |
2 | Development disorder | 1.60E-08–1.70E-02 |
3 | Hematological disease | 1.60E-08–1.03E-02 |
4 | Hereditary disorder | 1.60E-08–1.70E-02 |
5 | Gastrointestinal disease | 3.55E-08–8.34E-03 |
6 | Reproductive system disease | 4.46E-08–1.70E-02 |
Biological processes associated with CBX2-regulated genes (Oncomine analysis)
Rank | Concept name | p value | Q value | Odds ratio |
---|---|---|---|---|
1 | DNA replication and chromosome cycle | 2.3E-06 | 1.2E-04 | 39.0 |
2 | Mitotic chromosome condensation | 8.2E-04 | 2.4E-02 | 23.2 |
3 | Mitotic sister chromatid segregation | 8.2E-04 | 2.4E-02 | 23.2 |
4 | G1/S transition of mitotic cell cycle | 1.0E-02 | 1.8E-01 | 7.7 |
5 | Nucleotide-excision repair | 1.0E-02 | 1.8E-01 | 7.7 |
6 | Mitosis | 1.5E-06 | 7.9E-05 | 6.5 |
7 | DNA repair | 4.7E-08 | 3.1E-06 | 6.3 |
8 | DNA replication | 2.7E-06 | 1.4E-04 | 6.1 |
9 | Cytokinesis | 7.2E-07 | 4.1E-05 | 5.8 |
10 | Chromosome organization and biogenesis | 1.0E-03 | 4.0E-02 | 4.6 |
11 | Cell Cycle | 2.3E-05 | 1.0E-03 | 3.9 |
12 | Regulation of cell cycle | 4.0E-03 | 8.0E-02 | 2.6 |
13 | Intracellular signaling cascade | 6.1E-04 | 1.9E-02 | 2.4 |
Expression of CBX2-regulated genes involved in mitosis following CBX2 silencing
Gene | Fold change | p value | Gene | Fold change | p value |
---|---|---|---|---|---|
CENP family | SMC family | ||||
CENPA | −3.1 | 2.1E-03 | SMC1 | −2.0 | 3.3E-02 |
CENPE | −3.0 | 1.6E-04 | SMC2 | −2.7 | 1.4E-04 |
CENPH | −2.9 | 4.4E-03 | SMC3 | −1.3 | 3.4E-03 |
CENPI | −3.0 | 1.7E-03 | SMC4 | −2.9 | 1.1E-03 |
CENPK | −2.4 | 1.0E-03 | SMC6 | −1.5 | 3.0E-03 |
CENPL | −1.8 | 5.6E-03 | Mitotic signaling proteins | ||
CENPN | −1.9 | 1.1E-04 | AURKA | −2.6 | 3.7E-04 |
CENPO | −2.4 | 4.2E-03 | AURKB | −3.4 | 1.3E-03 |
CENPP | −1.6 | 2.4E-02 | CCNB1 | −2.4 | 5.0E-04 |
CENPQ | −1.8 | 1.1E-03 | KI67 | −2.0 | 1.2E-04 |
CENPW | −2.8 | 1.1E-03 | CDK1 | −2.3 | 2.2E-04 |
SKA family | CDC25A | 2.2 | 6.7E-04 | ||
SKA1 | −3.0 | 1.4E-04 | PLK1 | −2.7 | 1.0E-02 |
SKA2 | −2.1 | 4.9E-03 | PLK3 | −1.4 | 4.8E-05 |
SKA3 | −2.8 | 3.5E-05 | PLK4 | −2.9 | 1.5E-03 |
Clinical analysis of CBX2-regulated genes
Clinical analysis of CBX2 and CBX2-regulated genes in the MSKCC prostate adenocarcinoma cohort. a Heatmap showing the expression of the 544 genes differentially expressed after knocking-down CBX2. Here, only the 140 patients with gene expression data are shown. The columns (patients) were sorted based on CBX2 expression (red: high expression, blue: low expression). Metastatic prostate cancer patients had significantly higher CBX2; b CBX2 expression correlated with the expression of the differently expressed genes; c CBX2 expression distribution across the 140 patients. Here, we used a CBX2 expression threshold of 2 to call CBX2 up-regulation since there was a natural gap around expression value of 2; d Patients with CBX2 expression up-regulation had significantly lower disease-free survival
Finally, we determined whether CBX2 expression had an impact on clinical outcome. We first created a density plot demonstrating the spectrum of CBX2 expression in PCa. Since there was a natural cutoff at CBX2 expression around 2, we separated patients based on this cutoff and performed logrank test (Fig. 6c). Analysis of the resulting Kaplan-Meier curve indicated that patients with higher CBX2 expression displayed a significantly lower disease-free survival compared to patients with lower CBX2 levels (Fig. 6d, p = 0.0021, logrank test). Taken together, these findings demonstrate that CBX2 expression correlates with specific gene expression programs in patients and is associated with poor clinical outcome.
Discussion
Despite numerous large-scale sequencing efforts, very few genetic mutations are recurrently found in PCa, suggesting that epigenetic alterations likely contribute to PCa progression [33]. Recent studies have highlighted a critical role for the PcG family of epigenetic repressors in PCa cell survival and metastasis [17]. We therefore analyzed the expression of all PcG members in paired primary/metastatic PDXs and clinical datasets of PCa. Our results demonstrate that CBX2 is the most highly up-regulated PcG member across multiple models of metastatic and castration-resistant PCa and that elevated CBX2 levels correlate with poor clinical outcome. Moreover, we show for the first time that CBX2 depletion induced PCa cell death in vitro, which was accompanied by differential expression of key genes regulating PCa progression. Taken together, these results position CBX2 as a putative therapeutic target in advanced PCa.
CBX2 up-regulation was first identified in our paired non-metastatic (LTL313B) and metastatic (LTL313H) PDXs implanted into the subrenal capsule of NOD-SCID mice [29]. We have previously shown that this type of PDX conserves the molecular profile of the parental patient tumor. A particular feature of the LTL313B/H model is that both tumor lines originate from different foci of a single localized tumor, thus properly recapitulating the intra-tumoral heterogeneity observed in clinical PCa [29]. In the LTL313B/H model, we observed a high expression of CBX2 solely in the metastatic tumor line LTL313H. Based on this model, our results suggest that a small population of CBX2-expressing PCa cells within the primary tumor is the likely seed of metastatic dissemination. Consistent with this notion, we have also shown that CBX2 expression is elevated in metastatic tumors compared to those remaining local to the prostate. This is in accordance with our in vitro studies, which demonstrate that CBX2 depletion induced death in two metastatic PCa cell lines. Further supporting this idea, CBX2 inhibition resulted in up-regulation of PI3K antagonists such as PIK3R1 and INPP5A. In turn, this would result in activation of the pro-metastatic PI3K/AKT pathway, which is known to be altered in the vast majority of CRPC patients [34].
Currently, a major clinical challenge lies in identifying patients who will develop lethal, disseminated PCa and those who will not progress to metastatic disease [35]. Given the strong association between CBX2 and aggressive PCa, the expression of CBX2 could provide prognostic information. We found that elevated CBX2 levels independently predicted high grade, metastatic dissemination, and disease-free survival in PCa patients. However, as observed in the LTL313B/H model, there exists intra-tumoral heterogeneity within primary PCa such that molecular analyses resulting from a single biopsy site may not detect all CBX2-overexpressing foci. Therefore, we propose that positive CBX2 IHC staining in at least one core biopsy could be incorporated as an unfavorable prognostic marker that could be interpreted in the context of currently used methods such as TNM staging and Gleason score.
In line with the idea that CBX2 promotes tumor progression, the biological processes and functions associated with CRGs were intricately related with proliferation. These properties are consistent with phenotypic features of CBX2-deficient animals which exhibit multi-organ hypocellularity as a result of a proliferative block [25]. Further linking CBX2 and cell cycle progression, the analysis of CRGs revealed that a large number of proteins involved in mitotic spindle assembly are significantly down-regulated upon CBX2 silencing. In the literature, there is evidence demonstrating that CBX2 directly contributes to cell cycle progression through its association with condensed chromatin [36, 37]. Here, we expand on this mitotic function and show that, in addition, CBX2 also ensures integrity of cell division indirectly via the regulation of CRGs involved in mitotic spindle assembly. Moreover, CRGs included targetable kinases of the aurora kinase (AURKA, B) and the polo-like kinase (PLK1, 3, 4) families, all of which have been shown to promote G2/M transition. Taken together, these results suggest that CBX2 represents a key regulator of mitosis in CRPC, in line with its reported role in cellular proliferation.
A striking phenotype of CBX2-KO animals and humans is that XY subjects undergo male-to-female reversal, implying that CBX2 is required for the development of the male urogenital system [27]. While this feature suggests that CBX2 may cooperate with AR activity, our data indicates that CBX2 is antagonistically regulated by ligand-dependent AR signaling. Given the pro-survival properties conferred by CBX2 in vitro, we posit that CBX2 up-regulation may serve as an adaptive mechanism to bypass the anti-tumor response elicited by castration. Currently, an emerging clinical problem is that CRPC patients are becoming increasingly susceptible to transdifferentiation into highly aggressive neuroendocrine prostate cancer (NEPC) as a result of treatment with novel AR suppressors [38]. We have recently demonstrated that a number of PcG genes including CBX2 were overexpressed in NEPC [39]. Given the up-regulation of CBX2 in both CRPC and NEPC, we posit that CBX2 is required for tumor cell survival following castration but that other molecular mechanisms define specialization into neuroendocrine or epithelial lineages. As a consequence, development of CBX2 antagonists may benefit patients with late-stage disease by simultaneously blocking the progression of CRPC and NEPC.
While CBX2 antagonism represents a promising therapeutic strategy, there are no inhibitors of CBX2 currently available. From a drug development standpoint, CBX2 possesses a chromodomain that binds H3K27me3 with high affinity and could be pharmacologically targeted. Adding value to this strategy, studies have shown that PRC1 complexes found at H3K27me3 sites were enriched in CBX2 compared to other CBX family members. To date, antagonists have been developed for a number of chromodomains, including that of CBX7. Since the chromodomains of CBX7 and CBX2 are largely conserved but display some structural differences, it is possible to synthesize small molecules with selectivity for CBX2. Thus, these compounds could disrupt the interaction between CBX2 and H3K27me3, providing a specific mechanism to inhibit CBX2 activity and reverse abnormal gene expression programs. In conclusion, this study provides the first evidence that the H3K27me3 reader CBX2 is functionally involved in any human cancer, thereby adding to the growing landscape of cancer epigenetics.
Conclusions
There are currently no curative options for castration-resistant prostate cancer and thus there is a dire need to identify new potential therapeutic targets. We identified the polycomb group (PcG) member and epigenetic reader CBX2 as the most highly expressed PcG gene in metastatic and castration-resistant prostate cancers. Elevated expression correlated with aggressive disease and poor clinical outcomes. Functional analysis revealed that CBX2 is critical for prostate cancer cell survival. Our work positions CBX2 as a novel potential therapeutic target in CRPC.
Methods
Patient-derived xenograft models
As previously reported, the Living Tumor Lab (LTL, www.livingtumorlab.com) has developed a collection of high-fidelity PDXs implanted into the subrenal capsule of NOD-SCID mice [29]. We used the LTL313B/LTL313H model to investigate the role of CBX2 in metastasis and the LTL313B/BR model to assess the implications of CBX2 in drug-resistant CRPC [29]. Tumor tissues were obtained from patients through a protocol approved by the Clinical Research Ethics Board of the University of British Columbia (UBC) and the BC Cancer Agency (BCCA). All patients signed a consent form approved by the Ethics Board (UBC Ethics Board #: H09-01628 and H04-60131; VCHRI #: V09-0320 and V07-0058). Animal care and experimental procedures were carried out in accordance with the guidelines of the Canadian Council of Animal Care (CCAC) under the approval of the Animal Care Committee of University of British Columbia (permit #: A10-0100). The microarray gene expression data for these tumor lines have been previously deposited in the NCBI Gene Expression Omnibus (GEO) and are freely available under the accession number GSE41193.
Bioinformatic database analysis
The Oncomine database was used to compare the expression of CBX2 between metastatic and non-metastatic PCa [30]. Data was acquired in an unbiased fashion by compiling all the Oncomine studies with significantly altered CBX2 expression (p ≤ 0.05). The cBIO portal (http://www.cbioportal.org/) was used to assess the genomic alterations affecting the CBX2 locus in PCa. In addition, the MSKCC dataset [31] was extracted from cBIO portal. Using this dataset, correlation between CBX2 and all other genes were calculated using the Pearson and Spearman correlation tests.
Cell culture
All cell lines were maintained in RPMI 1640 growth medium (GIBCO) supplemented with 10 % fetal bovine serum (GIBCO) at 37 °C and 5 % CO2. For the androgen depletion experiment, LNCaP cells were initially plated in conditions described above for 24 h, following which media was changed to RPMI 1640 (GIBCO) supplemented with charcoal-stripped FBS (GIBCO), which has the property of being completely free of steroid hormones [40]. This charcoal-stripped media was then itself supplemented with DHT (10 nM) or not, and the cells were harvested at 6, 24, and 48 h after media change for qPCR analysis.
qRT-PCR
qRT-PCR primers
Gene | Direction | Sequence (5′-3′) |
---|---|---|
CBX2 | Forward | ATCGAGCACGTATTTGTCAC |
CBX2 | Reverse | AGTAATGCCTCAGGTTGAAG |
CENPF | Forward | GAGGACCAACACCTGCTACC |
CENPF | Reverse | GGCTAGTCTTTCCTGTCGGG |
CEP55 | Forward | CCGTTGTCTCTTCGATCGCT |
CEP55 | Reverse | GGCTTCGATCCCCACTTACT |
DICER1 | Forward | TGAAATGCTTGGCGACTCCT |
DICER1 | Reverse | GCCAATTCACAGGGGGATCA |
FOXM1 | Forward | ATAGCAAGCGAGTCCGCATT |
FOXM1 | Reverse | AGCAGCACTGATAAACAAAGAAAGA |
HPRT1 | Forward | GGTCAGGCAGTATAATCCAAAG |
HPRT1 | Reverse | CGATGTCAATAGGACTCCAGATG |
INPP5A | Forward | TGTGACCGCATCCTCATGTC |
INPP5A | Reverse | TGATTCGGAAGGCCAGGAAC |
ITGB8 | Forward | TTTGTCTGCCTGCAAAACGA |
ITGB8 | Reverse | GCACAGGATGCTGCATTTGA |
MKI67 | Forward | TGAGCCTGTACGGCTAAAACA |
MKI67 | Reverse | GGCCTTGGAATCTTGAGCTTT |
PIK3R1 | Forward | GATTCTCAGCAGCCAGCTCTGAT |
PIK3R1 | Reverse | GCAGGCTGTCGTTCATTCCAT |
TERT | Forward | GAGAACAAGCTGTTTGCGGG |
TERT | Reverse | AAGTTCACCACGCAGCCATA |
TIMP2 | Forward | GCGGTCAGTGAGAAGGAAGT |
TIMP2 | Reverse | GGAGGGGGCCGTGTAGATAA |
Western blot
Cell lysis was done using radioimmunoprecipitation assay (RIPA) buffer supplemented with a protease inhibitor cocktail (Roche). Bicinchoninic acid (BCA) protein assay (Thermo Fisher Scientific) was conducted to quantify protein concentrations in the resulting lysates. Fifteen micrograms of proteins were run on a 10 % sodium dodecyl sulfate polyacrylamide gel, transferred to a nitrocellulose membrane (Bio-Rad), and subjected to Western blot analysis. Primary rabbit antibodies specific to CBX2 (Thermo Fisher Scientific, Cat # PA5-30996, 1:1000) and actin (Thermo Fisher Scientific, Cat # PA1-16889, 1:4000) were incubated overnight at 4 °C, and goat anti-rabbit secondary antibody (Thermo Fisher Scientific, Cat # 31460, 1:15 000) was detected using electrochemiluminescence (ECL) kit (Thermo Fisher Scientific) according to the manufacturer’s protocol.
Microscopy
Light microscopy images were obtained using the Axiovert 40 CFL (Zeiss) and the Axioplan 2 (Zeiss).
siRNA knockdown
Twenty-four hours after seeding, cells at a confluency of 30–50 % were treated with 8 nm CBX2-specific or non-targeting siRNA (ON-TARGET plus siRNA, Dharmacon). Lipofectamine 2000 (Invitrogen) was used as the transfecting agent according to the manufacturer’s protocol, and cells were subjected to functional assays 24 to 120 h post-transfection.
Caspase 3–7 activity
Seventy-two hours after CBX2 or non-targeting siRNA treatment in LNCaP and C4-2 (as described earlier), the relative caspase 3/7 activity was assessed using the Caspase-Glo 3/7 assay (Promega) according to the manufacturer’s protocol and chemiluminescence was measured with a spectrophotometer (Thermo Fisher Scientific).
MTT analysis
At 1, 3, and 5 days post-treatment with siRNA, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) solution (5 mg/ml, Sigma) was added to media and incubated for 3.5 h, after which, the cells were solubilized with dimethyl sulfoxide (DMSO) and absorbance was read at 570 nm using a spectrophotometer (Thermo Fisher Scientific).
Microarray analysis
RNA was extracted from C4-2 cells treated with CBX2-specific or non-targeting siRNA 55 h post-treatment in triplicate, using the RNA isolation protocol described above in the qRT-PCR section. RNA quality was assessed using the Agilent 2100 Bioanalyzer. Samples were subjected to microarray analysis using the Agilent human GE 8x60 v1 array at the Laboratory for Advanced Genomic Analysis (LAGA) in Vancouver, BC. Differential gene expression was quantified using T test unpaired unequal variance (Welch), and p values were corrected for multiple testing using the Benjamini-Hochberg correction (p ≤ 0.05).
Immunohistochemistry
The preparation of paraffin-embedded tissue sections and IHC were carried out as previously described [29, 41]. A CBX2-specific primary antibody was used (rabbit polyclonal, Pierce) and was recognized by a goat anti-rabbit secondary antibody (Vector Laboratory).
Statistical analysis
Unsupervised hierarchical clustering and multivariate analysis of variance (MANOVA) were conducted using the R statistical package. Computational analyses of CBX2-regulated transcripts were carried out with the IPA software (Qiagen, June 2014 release). Unless otherwise mentioned, all analyses were done using p ≤ 0.05 (denoted as * in figures) as the significance threshold with the GraphPad Prism software (version 6).
Declarations
Acknowledgements
Funding for this work was provided by the Canadian Cancer Society Research Institute (CDH), Canadian Institutes of Health Research (YW), Terry Fox Research Institute (YW), Prostate Cancer Canada (CC, YW), BC Cancer Foundation (YW), Michael Smith Foundation for Health Research (FC), and Canadian Cancer Society Research Institute (YW).
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Authors’ Affiliations
References
- Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, 2014. CA Cancer J Clin. 2014;64:9–29.View ArticlePubMedGoogle Scholar
- Horwich A, Hugosson J, de Reijke T, et al. Prostate cancer: ESMO consensus conference guidelines 2012. Ann Oncol. 2013;24:1141–62.View ArticlePubMedGoogle Scholar
- Feldman BJ, Feldman D. The development of androgen-independent prostate cancer. Nat Rev Cancer. 2001;1:34–45.View ArticlePubMedGoogle Scholar
- Tannock IF, de Wit R, Berry WR, et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. N Engl J Med. 2004;351:1502–12.View ArticlePubMedGoogle Scholar
- Beer TM, Armstrong AJ, Rathkopf DE, et al. Enzalutamide in metastatic prostate cancer before chemotherapy. N Engl J Med. 2014;371:424–33.PubMed CentralView ArticlePubMedGoogle Scholar
- Perry AS, Watson RW, Lawler M, Hollywood D. The epigenome as a therapeutic target in prostate cancer. Nat Rev Urol. 2010;7:668–80.View ArticlePubMedGoogle Scholar
- Berger SL, Kouzarides T, Shiekhattar R, Shilatifard A. An operational definition of epigenetics. Genes Dev. 2009;23:781–3.PubMed CentralView ArticlePubMedGoogle Scholar
- Strahl BD, Allis CD. The language of covalent histone modifications. Nature. 2000;403:41–5.View ArticlePubMedGoogle Scholar
- Hon GC, Rajagopal N, Shen Y, et al. Epigenetic memory at embryonic enhancers identified in DNA methylation maps from adult mouse tissues. Nat Genet. 2013;45:1198–206.PubMed CentralView ArticlePubMedGoogle Scholar
- Gupta RA, Shah N, Wang KC, et al. Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature. 2010;464:1071–6.PubMed CentralView ArticlePubMedGoogle Scholar
- Esteller M. Epigenetics in cancer. N Engl J Med. 2008;358:1148–59.View ArticlePubMedGoogle Scholar
- Arrowsmith CH, Bountra C, Fish PV, et al. Epigenetic protein families: a new frontier for drug discovery. Nat Rev Drug Discov. 2012;11:384–400.View ArticlePubMedGoogle Scholar
- Varambally S, Dhanasekaran SM, Zhou M, et al. The polycomb group protein EZH2 is involved in progression of prostate cancer. Nature. 2002;419:624–9.View ArticlePubMedGoogle Scholar
- Senthilkumar R, Mishra RK. Novel motifs distinguish multiple homologues of Polycomb in vertebrates: expansion and diversification of the epigenetic toolkit. BMC Genomics. 2009;10:549.PubMed CentralView ArticlePubMedGoogle Scholar
- Cao R, Wang L, Wang H, et al. Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science. 2002;298:1039–43.View ArticlePubMedGoogle Scholar
- Kaustov L, Ouyang H, Amaya M, et al. Recognition and specificity determinants of the human cbx chromodomains. J Biol Chem. 2011;286:521–9.PubMed CentralView ArticlePubMedGoogle Scholar
- Berezovska OP, Glinskii AB, Yang Z, et al. Essential role for activation of the Polycomb group (PcG) protein chromatin silencing pathway in metastatic prostate cancer. Cell Cycle. 2006;5:1886–901.View ArticlePubMedGoogle Scholar
- Gao Z, Zhang J, Bonasio R, et al. PCGF homologs, CBX proteins, and RYBP define functionally distinct PRC1 family complexes. Mol Cell. 2012;45:344–56.PubMed CentralView ArticlePubMedGoogle Scholar
- Crea F, Hurt EM, Mathews LA, et al. Pharmacologic disruption of polycomb repressive complex 2 inhibits tumorigenicity and tumor progression in prostate cancer. Mol Cancer. 2011;10:40.PubMed CentralView ArticlePubMedGoogle Scholar
- Crea F, Duhagon Serrat MA, Hurt EM, et al. BMI1 silencing enhances docetaxel activity and impairs antioxidant response in prostate cancer. Int J Cancer. 2011;128:1946–54.PubMed CentralView ArticlePubMedGoogle Scholar
- Klauke K, Radulović V, Broekhuis M, et al. Polycomb Cbx family members mediate the balance between haematopoietic stem cell self-renewal and differentiation. Nat Cell Biol. 2013;15:353–62.View ArticlePubMedGoogle Scholar
- Clermont PL, Sun L, Crea F, et al. Genotranscriptomic meta-analysis of the polycomb gene CBX2 in human cancers: initial evidence of an oncogenic role. Br J Cancer. 2014;111:1663.PubMed CentralView ArticlePubMedGoogle Scholar
- Katoh-Fukui Y, Owaki A, Toyama Y, et al. Mouse polycomb M33 is required for splenic vascular and adrenal gland formation through regulating Ad4BP/SF1 expression. Blood. 2005;106:1612–20.View ArticlePubMedGoogle Scholar
- Coré N, Joly F, Boned A, Djabali M. Disruption of E2F signaling suppresses the INK4a-induced proliferative defect in M33-deficient mice. Oncogene. 2004;23:7660–8.View ArticlePubMedGoogle Scholar
- Coré N, Bel S, Gaunt SJ, et al. Altered cellular proliferation and mesoderm patterning in polycomb-M33-deficient mice. Development. 1997;124:721–9.PubMedGoogle Scholar
- Biason-Lauber A, Konrad D, Meyer M, et al. Ovaries and female phenotype in a girl with 46, XY karyotype and mutations in the CBX2 gene. Am J Hum Genet. 2009;84:658–63.PubMed CentralView ArticlePubMedGoogle Scholar
- Katoh-Fukui Y, Tsuchiya R, Shiroishi T, et al. Male-to-female sex reversal in M33 mutant mice. Nature. 1998;393:688–92.View ArticlePubMedGoogle Scholar
- Chen Q, Watson JT, Marengo SR, et al. Gene expression in the LNCaP human prostate cancer progression model: progression associated expression in vitro corresponds to expression changes associated with prostate cancer progression in vivo. Cancer Lett. 2006;244:274–88.View ArticlePubMedGoogle Scholar
- Lin D, Wyatt AW, Xue H, et al. High fidelity patient-derived xenografts for accelerating prostate cancer discovery and drug development. Cancer Res. 2014;74:1272–83.View ArticlePubMedGoogle Scholar
- Rhodes DR, Kalyana-Sundaram S, Mahavisno V, et al. Oncomine 3.0: genes, pathways, and networks in a collection of 18,000 cancer gene expression profiles. Neoplasia. 2007;9:166–80.PubMed CentralView ArticlePubMedGoogle Scholar
- Taylor BS, Schultz N, Hieronymus H, et al. Integrative genomic profiling of human prostate cancer. Cancer Cell. 2010;18:11–22.PubMed CentralView ArticlePubMedGoogle Scholar
- Liu AY, Brubaker KD, Goo YA, et al. Lineage relationship between LNCaP and LNCaP-derived prostate cancer cell lines. Prostate. 2004;60:98–108.View ArticlePubMedGoogle Scholar
- Grasso CS, Wu YM, Robinson DR, et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 2012;487:239–43.PubMed CentralView ArticlePubMedGoogle Scholar
- Edlind MP, Hsieh AC. PI3K-AKT-mTOR signaling in prostate cancer progression and androgen deprivation therapy resistance. Asian J Androl. 2014;16:378–86.PubMed CentralView ArticlePubMedGoogle Scholar
- Chang AJ, Autio KA, Roach M, Scher HI. High-risk prostate cancer-classification and therapy. Nat Rev Clin Oncol. 2014;11:308–23.PubMed CentralView ArticlePubMedGoogle Scholar
- Zhen CY, Duc HN, Kokotovic M, et al. Cbx2 stably associates with mitotic chromosomes via a PRC2- or PRC1-independent mechanism and is needed for recruiting PRC1 complex to mitotic chromosomes. Mol Biol Cell. 2014;25:3726–39.PubMed CentralView ArticlePubMedGoogle Scholar
- Tardat M, Albert M, Kunzmann R, et al. Cbx2 targets PRC1 to constitutive heterochromatin in mouse zygotes in a parent-of-origin-dependent manner. Mol Cell. 2015;58:157–71.View ArticlePubMedGoogle Scholar
- Wang HT, Yao YH, Li BG, et al. Neuroendocrine prostate cancer (NEPC) progressing from conventional prostatic adenocarcinoma: factors associated with time to development of NEPC and survival from NEPC diagnosis-a systematic review and pooled analysis. J Clin Oncol. 2014;32:3383–90.View ArticlePubMedGoogle Scholar
- Clermont PL, Lin D, Crea F, et al. Polycomb-mediated silencing in neuroendocrine prostate cancer. Clin Epigenetics. 2015;7:40.PubMed CentralView ArticlePubMedGoogle Scholar
- Shen R, Dorai T, Szaboles M, et al. Transdifferentiation of cultured human prostate cancer cells to a neuroendocrine cell phenotype in a hormone-depleted medium. Urol Oncol. 1997;3:67–75.View ArticlePubMedGoogle Scholar
- Lin D, Watahiki A, Bayani J, et al. ASAP1, a gene at 8q24, is associated with prostate cancer metastasis. Cancer Res. 2008;68:4352–9.View ArticlePubMedGoogle Scholar