Skip to main content

Advertisement

Table 6 qRT-PCR primers

From: Identification of the epigenetic reader CBX2 as a potential drug target in advanced prostate cancer

Gene Direction Sequence (5′-3′)
CBX2 Forward ATCGAGCACGTATTTGTCAC
CBX2 Reverse AGTAATGCCTCAGGTTGAAG
CENPF Forward GAGGACCAACACCTGCTACC
CENPF Reverse GGCTAGTCTTTCCTGTCGGG
CEP55 Forward CCGTTGTCTCTTCGATCGCT
CEP55 Reverse GGCTTCGATCCCCACTTACT
DICER1 Forward TGAAATGCTTGGCGACTCCT
DICER1 Reverse GCCAATTCACAGGGGGATCA
FOXM1 Forward ATAGCAAGCGAGTCCGCATT
FOXM1 Reverse AGCAGCACTGATAAACAAAGAAAGA
HPRT1 Forward GGTCAGGCAGTATAATCCAAAG
HPRT1 Reverse CGATGTCAATAGGACTCCAGATG
INPP5A Forward TGTGACCGCATCCTCATGTC
INPP5A Reverse TGATTCGGAAGGCCAGGAAC
ITGB8 Forward TTTGTCTGCCTGCAAAACGA
ITGB8 Reverse GCACAGGATGCTGCATTTGA
MKI67 Forward TGAGCCTGTACGGCTAAAACA
MKI67 Reverse GGCCTTGGAATCTTGAGCTTT
PIK3R1 Forward GATTCTCAGCAGCCAGCTCTGAT
PIK3R1 Reverse GCAGGCTGTCGTTCATTCCAT
TERT Forward GAGAACAAGCTGTTTGCGGG
TERT Reverse AAGTTCACCACGCAGCCATA
TIMP2 Forward GCGGTCAGTGAGAAGGAAGT
TIMP2 Reverse GGAGGGGGCCGTGTAGATAA