Skip to main content

Insulin resistance is associated with epigenetic and genetic regulation of mitochondrial DNA in obese humans

Abstract

Background

Mitochondrial alterations have been observed in subjects with metabolic disorders such as obesity and diabetes. Studies on animal models and cell cultures suggest aberrant glucose and lipid levels, and impaired insulin signaling might lead to mitochondrial changes. However, the molecular mechanism underlying mitochondrial aberrance remains largely unexplored in human subjects.

Results

Here we show that the mitochondrial DNA copy number (mtDNAn) was significantly reduced (6.9-fold lower, p < 0.001) in the leukocytes from obese humans (BMI >30). The reduction of mtDNAn was strongly associated with insulin resistance (HOMA-IR: −0.703, p < 0.05; fasting insulin level: −0.015, p < 0.05); by contrast, the correlation between fasting glucose or lipid levels and mtDNAn was not significant. Epigenetic study of the displacement loop (D-loop) region of mitochondrial genome, which controls the replication and transcription of the mitochondrial DNA as well as organization of the mitochondrial nucleoid, revealed a dramatic increase of DNA methylation in obese (5.2-fold higher vs. lean subjects, p < 0.05) and insulin-resistant (4.6-fold higher vs. insulin-sensitive subjects, p < 0.05) individuals.

Conclusions

The reduction of mtDNAn in obese human subjects is associated with insulin resistance and may arise from increased D-loop methylation, suggesting an insulin signaling-epigenetic-genetic axis in mitochondrial regulation.

Background

The epidemic of obesity is growing globally. In addition to the changes in glucose and lipid metabolism, obesity is associated with insulin resistance and increased risk of type 2 diabetes (T2D) and cardiovascular diseases (CVD) [13]. As the primary metabolic platform in mammalian cells, mitochondria undergo genetic and epigenetic regulation, which leads to alterations in mitochondrial function, dynamics, and biogenesis during metabolic disorders [2, 4, 5]. Decrease in mitochondrial DNA copy number (mtDNAn) has been observed in skeletal muscle, adipose tissue, and peripheral blood from obese and T2D individuals [615]. The reduced mtDNAn in peripheral blood was found to precede the development of T2D [10, 16]. In addition, DNA methyltransferase 1 (DNMT1) can translocate to the mitochondria and catalyze mitochondrial DNA (mtDNA) methylation, thereby manipulating the expression of transcripts from the heavy and light strands of mtDNA [17]. It was shown that, in the elderly or individuals with insulin resistance and T2D, mitochondrial COX7A1 (the subunit of cytochrome c oxidase or complex IV in the respiratory chain) and NDUFB6 (subunit in complex I in the respiratory chain) were dysregulated, concomitant with higher DNA methylation in the promoters of COX7A1 and NDUFB6 [18, 19]. Recently, Pirola et al. found that the methylation of MT-ND6 (mitochondrial NADH dehydrogenase) was higher in the liver of nonalcoholic steatohepatitis (NASH) than simple steatosis patients, and MT-ND6 methylation inversely correlated with MT-ND6 transcription and protein expression in the liver of NASH patients [20]. The change in MT-ND6 methylation was significantly associated with nonalcoholic fatty liver-disease activity score [20]. These findings suggest that changes in mtDNAn and mtDNA methylation may play an important role in metabolic disorders.

Mitochondrial alteration reflects metabolic status. The genes and proteins controlling mitochondrial dynamics can be dysregulated by high glucose, leading to overproduction of reactive oxygen species and insulin resistance [2126]. The evidence from genetically modified mice suggested that overloading mitochondria by lipids led to incomplete fatty acid oxidation, mitochondrial stress, and impaired insulin signaling [27, 28]. A feedback loop was recently discovered, showing that insulin resistance results in mitochondrial changes in cell and animal models, as well as in human subjects [2932]. However, it is not well defined how the metabolic changes might be related to genetic and epigenetic regulation of mitochondria. In this study, we recruited obese and lean subjects to investigate the mtDNAn and DNA methylation in the displacement loop (D-loop) region of the mitochondrial genome, which controls the replication of mtDNA and organization of the mitochondrial nucleoid [3335]. We detected a significantly increased DNA methylation in the D-loop region, which was concomitant with decreased mtDNAn in the obese individuals when they were compared with the lean subjects. Moreover, the change in mtDNAn was strongly associated with insulin resistance, but not with impaired fasting glucose or dyslipidemia (e.g., triglyceride, cholesterol, and VLDL). Our study provides new evidence critical for the ongoing journey in discovering mtDNA methylation and exploring its role in metabolic regulation [1820, 36] and suggests an insulin signaling-epigenetic-genetic axis that may control mitochondrial regulation.

Results

Metabolic changes in obese subjects

Among the 40 participants, 32 people had a BMI greater than 30 (mean value = 36.6; referred to later as obese group) and 8 showed BMI below 25 (mean value = 23.1; referred to later as lean group), with the difference between the two groups being significant (p < 0.0001). As shown in Table 1 and Additional file 1: Figure S1, the obese group showed a significant impairment in fasting glucose (95.9 ± 2.4 vs. 83.9 ± 1.9 in the lean group, p < 0.05), and fasting insulin levels dramatically increased (21.8 ± 2.5 vs. 9.4 ± 1.6 in the lean group, p < 0.05), suggestive of impaired insulin sensitivity or development of insulin resistance [37, 38]. Insulin resistance was further confirmed by the HOMA-IR value, which was 2.7-fold (p < 0.05) higher in the obese group than in the lean one. Moreover, the plasma LDL level (115.6 ± 4.8 vs. 94.4 ± 8.3, p < 0.05), low-density lipoprotein (LDL)/high-density lipoprotein (HDL) ratio (2.2 ± 0.1 vs. 1.7 ± 0.2, p < 0.05), and total cholesterol/HDL ratio (3.8 ± 0.2 vs. 3.0 ± 0.3, p < 0.05) all showed significant elevation. These findings suggest that the obese group had impairment in insulin signaling, concurrent with aberrant glucose and lipid metabolism.

Table 1 Demographic and metabolic characteristics of participants

mtDNAn was reduced in obese subjects

The mitochondrial genome or mtDNA encodes 13 protein components of the respiration chain that underpin mitochondrial function [39, 40]. We found that the mtDNAn in the obese group was 6.9-fold lower (delta log-mtDNAn = 0.84, p < 0.001) when compared with their lean counterparts (Fig. 1). Given the significant age difference shown in Table 1 and Additional file 1: Figure S1, we conducted an age-matched analysis of mtDNAn, which indicated an mtDNAn tenfold lower (delta log-mtDNAn = 0.99, p < 0.05) in obese the group than in the lean group (Additional file 2: Figure S2). This is consistent with a previous report showing lower mitochondrial content in the skeletal muscle and adipose tissues from obese individuals [79, 11]. Because changes in mtDNAn can affect the integrity, assembly, and operation of the mitochondrial respiratory chain [41, 42], it is conceivable that the mitochondrial function or capacity is impaired in obese subjects.

Fig. 1
figure 1

Measurement of mitochondrial DNA copy number (mtDNAn) in lean (BMI <25 kg/m2) and obese (BMI >30 kg/m2) subjects. n = 8–32; **p < 0.001

Alteration of mtDNAn was associated with insulin resistance

To examine how mtDNAn alteration was associated with the metabolic changes in obese subjects, we compared the mtDNAn in the insulin-sensitive (InS) group with that of the insulin-resistant (InR) group by setting the cutoff point at 2.5 for HOMA-IR [43, 44]. The InR group had a mean value of HOMA-IR that was 3.8-fold higher than the InS group (p < 0.0001), indicative of impaired insulin action [43, 44]. However, the mtDNAn in the InR group was 3.2-fold lower (delta log-mtDNAn = 0.5, p < 0.05) in comparison with the InS group (Fig. 2). These findings support the notion that insulin resistance links mitochondrial alteration to metabolic disorder [2932, 45].

Fig. 2
figure 2

Measurement of mtDNAn in insulin-sensitive (InS) and insulin-resistant (InR) individuals. a HOMA-IR indicates InS and InR groups, with the cutoff point set at 2.5. b The mtDNAn was significantly lower in InR individuals than InS subjects. n = 13–27; *p < 0.05; ***p < 0.0001

Alteration of mtDNAn was independent from aberrant glucose and lipid levels

According to the American Diabetes Association (ADA), a value of less than 100 mg/dL is defined as normal fasting glucose (NFG), while a value greater than 100 but less than 125 mg/DL indicates impaired fasting glucose (IFG) [46]. In the IFG group, the fasting glucose level was 111 mg/dL on average, significantly higher than that of the NFG group (86 mg/dL on average, p < 0.0001). However, the mtDNAn values of these two groups showed no significant difference (Fig. 3). In addition, mtDNAn did not change with plasma lipid levels, irrespective of the aberrantly higher concentrations of plasma triglyceride, cholesterol, LDL, and VLDL (Fig. 4 and data not shown) [47]. Together, these results suggest that mtDNA alteration may arise from insulin resistance rather than aberrant glucose and lipid levels (Figs. 2, 3, and 4).

Fig. 3
figure 3

Measurement of mtDNAn in normal fasting glucose (NFG) and impaired fasting glucose (IFG) individuals. a Fasting glucose levels in NFG and IFG groups, with the cutoff point set at 100 mg/dL. b The mtDNAn in IFG individuals was comparable to that of NFG subjects. n = 11–29; ***p < 0.0001; NS, not significant

Fig. 4
figure 4

Measurement of mtDNAn in individuals with normal lipid levels and dyslipidemia. a, b the fasting plasma triglyceride (a) and mtDNAn (b) in individuals with normal triglyceride (NT) and high triglyceride (HT), with the cutoff point set at 150 mg/dL; n = 10–30. c, d the fasting plasma cholesterol (c) and mtDNAn (d) in individuals with normal cholesterol (NC) and high cholesterol (HC), with the cutoff point set at 200 mg/dL; n = 12–28. e, f the fasting plasma VLDL (e) and mtDNAn (f) in individuals with normal VLDL (n-VLDL) and high VLDL (h-VLDL), with the cutoff point set at 32 mg/dL; n = 9–31. ***p < 0.0001; NS, not significant

Regression analysis suggested an insulin signaling-mtDNAn axis

To further validate the relationship between mtDNAn and the metabolic parameters, we conducted regression analysis, and the results were shown in Table 2 and Additional file 3: Figure S3. Consistent with the above observation (Figs. 1, 2, 3, and 4), mtDNAn showed a negative correlation with BMI (−0.026; p < 0.05) and with HOMA-IR (−0.703, p < 0.05). Because fasting insulin levels can also indicate insulin resistance to some extent as HOMA-IR does, it was negatively correlated with mtDNAn (−0.015, p < 0.05) [37, 38]. By contrast, mtDNAn did not have a significant correlation with fasting glucose or lipid levels (Table 2 and Additional file 3: Figure S3). Additionally, age-dependent decrease of mtDNAn was not significant (Table 2 and Additional file 2: Figure S2), in line with the previously observed lack of mtDNAn change with age in human skeletal muscle and myocardium [41]. A recent study suggested that mtDNAn alteration in peripheral blood cells did not initialize until the age of 50 years [48], which may account for the lack of significant correlation between mtDNAn and age in this study as the majority of our participants were younger than 50 years. Together, our results suggest an insulin signaling-mtDNAn axis in human leukocytes (Fig. 2, Table 2, and Additional file 3: Figure S3).

Table 2 Univariate regression analysis of mtDNAn among all subjects

D-loop had higher methylation in obese subjects

The D-loop region controls the replication of the mitochondrial DNA and organization of the mitochondrial nucleoid [3335]. The observation of reduced mtDNAn in the obese individuals (Figs. 1 and 2) prompted us to ask whether the D-loop region underwent aberrant methylation, the modification that may regulate mtDNA replication and transcription [49]. Regression analysis suggested that mtDNAn was negatively correlated with D-loop methylation (−0.078; p < 0.05). Moreover, DNA methylation in the D-loop region was 5.2-fold higher in the obese group than in the lean group (p < 0.05, Fig. 5a). Interestingly, the increased methylation of D-loop was phenocopied by insulin-resistant (InR) subjects, and DNA methylation was 4.6-fold higher than that of insulin-sensitive (InS) subjects (p < 0.05, Fig. 5b). However, the difference of D-loop methylation was indiscernible between the NFG and IFG groups (Fig. 5c) or between normal triglyceride (NT) and hypertriglyceridemic (HT) groups (Fig. 5d). Therefore, the increased DNA methylation in the D-loop region was associated with insulin resistance but independent from aberrant glucose and lipid levels. Our data adds new and timely evidence to the potential role of mtDNA methylation in metabolic regulation [1820, 36].

Fig. 5
figure 5

Measurement of DNA methylation in the D-loop region of mitochondrial genome. a D-loop methylation in lean and obese subjects; n = 8–32. b D-loop methylation in InS and InR subjects; n = 13–27. c D-loop methylation in NFG and IFG individuals; n = 11–29. d D-loop methylation in NT and HT individuals; n = 10–30. The DNA methylation levels were also compared between NC and HC, n-VLDL, and h-VLDL groups, and there was no significant difference (not shown). *p < 0.05; NS, not significant

Discussion

The growing epidemic of obesity is largely attributed to the current life style of energy overconsumption with inadequate physical activity [2, 50, 51]. As such, the surplus of nutrients is accumulated and contributes to the interactions between genes and environment [2, 51]. Mitochondrial alterations have been observed in obese individuals, including impaired mitochondrial fatty acid/lipid oxidation capacity in the skeletal muscle and reduced mtDNAn in adipose tissues and peripheral blood samples [69, 11]. However, whether an epigenetic mechanism underlies the reduced mtDNAn has not been defined, and how genetic and epigenetic traits in mitochondria are related to altered metabolic parameters remains elusive. In this study, we found that the reduction of mtDNAn was associated with increased DNA methylation in the D-loop, the critical region that controls the replication of mtDNA, transcription and organization of the mitochondrial nucleoid (Figs. 1, 2, and 5) [3335, 49, 52, 53]. Moreover, mitochondrial genetic and epigenetic changes seem to be independent from impaired fasting glucose and dyslipidemia but have strong correlation with insulin resistance (Figs. 1, 2, 3, 4, 5, and Table 2). Our results suggest an insulin signaling-epigenetics-genetics axis in mitochondrial regulation. Given the ongoing debate on mtDNA methylation in the literature [36], our study provides new and timely evidence that paves the avenue to understanding metabolic changes in the view of mitochondrial epigenetics [1820].

Mitochondria have an independent circular genome of 16.5 kb in humans, encoding 13 proteins that assemble the electron transport chain and ATP synthase [39, 40]. Normal mtDNAn and the integrity of the mtDNA molecule account for a functional mitochondrial genome,and are critical for assembly and operation of the respiratory chain [41, 42]. In the obese and insulin-resistant individuals, mtDNAn was significantly reduced and concomitant with the elevation of DNA methylation in the D-loop region, the event that may suppress mitochondrial transcripts and assembly of the respiration chain (Figs. 1, 2, and 5) [2, 53, 54]. While further study is warranted to define how insulin resistance may directly induce the epigenetic and genetic changes, we envision that the recently identified mitochondrial DNMT1 may be an important player with the nicotinamide adenine dinucleotide (oxidized form) (NAD+)-dependent deacetylase SIRT1 [17, 29, 55]. It was shown that DNMT1 could be de-acetylated by SIRT1 in a NAD+-dependent way, thereby manipulating DNMT1 activity in regulating gene expression [5658]. In insulin-resistant patients, the gene and protein levels of SIRT1 in peripheral blood cells were significantly reduced, while the expression of other sirtuin family members (SIRT2-SIRT7) was normal in comparison to insulin-sensitive individuals [55]. Moreover, our previous study demonstrated that insulin resistance could reduce cellular NAD+ levels and SIRT1 activity in vivo [29]. Thus, we propose that insulin resistance may regulate DNMT1 activity and DNA methylation in the D-loop region through NAD+-SIRT1, and this mechanism should be further explored in future studies.

Although aberrant lipid and glucose loads were previously shown to induce mitochondrial changes in cell cultures and animal models [23, 28], we did not observe a significant correlation between altered mtDNAn (or D-loop methylation) and fasting glucose or lipid levels (Figs. 3, 4, and Table 2), presumably because the changes in glucose and lipids were moderate (e.g., the impaired fasting glucose was 95.9 ± 2.4 mg/dL) or because the changes were still in a neonatal stage given that the timing and duration affect metabolic and mitochondrial phenotype [10, 59]. Regardless, insulin resistance shows strong association with altered D-loop methylation and mtDNAn (Fig. 2, Fig. 5, and Table 2). In fact, insulin can directly stimulate mitochondrial protein synthesis and promote mitochondrial function in healthy people, but these effects were absent in insulin-resistant subjects [60, 61]. These findings, along with our discovery of the insulin signaling-epigenetic-genetic axis in this study, strongly suggest that the primary link between insulin signaling and mitochondria is critical for normal metabolism. To this end, use of insulin sensitizers (e.g., pioglitazone and rosiglitazone) has been shown to increase mtDNAn and improve metabolic homeostasis [12, 62].

Conclusions

In summary, our present study reveals for the first time an insulin signaling-epigenetic-genetic axis that may regulate mitochondria. Particularly, our data adds new and timely evidence to the emerging role of mtDNA methylation in metabolic regulation, paving the avenue to understanding metabolic disorders from a mitochondrial epigenetics perspective [1820, 36]. Because this was a sub-study of a larger diabetes-prevention trial (diaBEAT-it trial), we were able to access only a limited amount of samples from the participants, not enabling us to conduct an in-depth study of the regulatory mechanism. However, SIRT1-DNMT1 cascade could play an important role because previous studies showed that only SIRT1 of the sirtuin family (SIRT1-SIRT7) underwent dysregulation in peripheral blood cells from insulin-resistant patients [55] and that SIRT1 directly interacted with DNMT1 and regulated its activity in different cell types [5658]. Our future study will further establish this epigenetic-genetic regulatory axis, so that novel mechanistic support and guidelines may be provided for lifestyle interventions (e.g., physical activity) through enhancing insulin sensitivity and SIRT1 activity [63, 64].

Methods

Subjects

We recruited 40 participants previously enrolled in a larger diabetes-prevention trial (diaBEAT-it trial), with diagnosis of no diabetes or cardiovascular disease [65]. All participants were consented by trained research staff and provided with a copy of their signed informed consent. Participants completed an intake questionnaire which included questions about medical history, current medications, and current health behaviors (e.g., physical activity and dietary behaviors). Additionally, resting blood-pressure measurements were recorded for all participants following standard protocols. All procedures were conducted in accordance with NIH Guidelines and approved by Institutional Review Boards at Carillion Clinic and at Virginia Tech.

Human experimental protocol

Body composition was determined by trained research staff via a dual-energy X-ray absorptiometry scan at the time of consent. An appointment for the blood draw was scheduled for each participant, and participants were instructed to fast overnight (10–12 h) before their scheduled blood draw at Solstas Labs facility (Roanoke, Virginia). Fasting venous blood samples were collected to determine biochemical indexes, including blood-lipid profile (triglyceride, total cholesterol, HDL-cholesterol, and LDL-cholesterol), fasting plasma glucose, HbA1c,and fasting plasma insulin. The homeostasis model assessment for insulin resistance (HOMA-IR) index was calculated as [fasting insulin (μU/ml) × fasting glucose (mg/dL)/405], as previously reported with minor modification due to different units used [10, 43]. Additional fasting blood was collected in EDTA tubes and was processed immediately to prepare white-blood cells (buffy coat), which were stored at −80 °C until further processing [66, 67].

DNA extraction and bisulfite treatment

DNA was isolated from the buffy coat using the QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany) by following the manufacturer’s instructions. EpiTect Bisulfite Kit (Qiagen) was used for bisulfite conversion and cleanup of DNA, during which unmethylated cytosines were converted to uracils and the methylated cytosines were conserved [20, 68]. DNA quality and quantity were examined with a Synergy H4 Hybrid Multi-Mode Microplate Reader (BioTek Instruments, Winooski, VT, USA) and then stored in aliquots at −20 °C until further assay.

Measurement of mtDNAn

Mitochondrial DNA copy number (mtDNAn) was measured as previously described [10, 41]. Briefly, 40 ng total DNA was used for real-time PCR with the iQ™ SYBR® Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA) on a ViiA™ 7 Real-Time PCR System (Life Technology, Grand Island, NY, USA). The primers used in this study were 5′-CCAACATCTCCGCATGA TGAAAC-3′ (forward) and 5′-TGAGTAGCCTCCTCAGATTC-3′ (reverse) for CYT-B (mtDNA); 5′-GTTACTGCCCTGTGGGGCAA-3′ (forward) and 5′-CAAAGGTGCCCTT GAGGTT-3′ (reverse) for β-globin (nuclear DNA). The amplicon lengths were 434 bp and 356 bp for CYT-B and β-globin, respectively.

Measurement of D-loop methylation

The methylation of D-loop region was determined by methylation-specific PCR as descried previously [20, 68]. Briefly, the D-loop sequence 16024–576 (1,122 bp) of the Homo sapiens mitochondrion genome (gi|251831106:c576-1, c16569-16024) was used to identify the CpG island (426–576) and design primers for PCR analysis. The following two pairs of primers were designed: one pair was specific for bisulfite-modified methylated DNA, and the other pair was specific for bisulfite-modified unmethylated DNA amplifying heavy strand. The primers used in this study were TAGGAATTAAAGATAGATATTGCGA (forward, starting position at 434 nt) and 5′-ACTCTCCA TACATTTAATATTTTCGTC-3′ (reverse, starting position at 539 nt) for methylated D-loop; 5′-GGTAGGAATTAAA GATAGATATTGTGA-3′ (forward, starting position at 432 nt) and 5′-ACTCTCCATACATTTAATATTTTCATC-3′ (reverse, starting position at 539 nt) for unmethylated D-loop. The bisulfite-modified DNA was used as a template for methylation-specific PCR (MSP) on a ViiA™ 7 Real-Time PCR System, using SYBR® Green PCR Master Mix (Life Technology, Grand Island, NY, USA). Two MSPs were performed simultaneously to detect the methylated (amplicon size; 106 bp) and unmethylated (amplicon size; 108 bp) D-loop for each sample. The percentage of methylated DNA is calculated as described previously [20, 68].

Statistics

The data are expressed as the mean ± SE unless otherwise specified. Logarithm-transformed data were used for the analysis of skewed variables, such as HOMA-IR and mtDNAn. Pearson’s correlation and regression analysis was applied to evaluate the relationships among mtDNAn and the metabolic indexes. Statistical significance was set at a probability level of p < 0.05.

Abbreviations

BMI:

body mass index

COX7A1:

the subunit of cytochrome c oxidase or complex IV in the respiratory chain

CVD:

cardiovascular diseases

D-loop:

displacement loop

DNMT1:

DNA methyltransferase 1

HC:

high cholesterol

HDL:

high-density lipoprotein

HOMA-IR:

the homeostatic model assessment (HOMA)-insulin resistance index

HT:

high triglyceride

h-VLDL:

high VLDL

IFG:

indicates impaired fasting glucose

InR:

insulin resistant

InS:

insulin sensitive

LDL:

low-density lipoprotein

mtDNA:

mitochondrial DNA

mtDNAn:

mitochondrial DNA copy number

NAD+ :

nicotinamide adenine dinucleotide (oxidized form)

NC:

normal cholesterol

NDUFB6:

subunit in complex I in the respiratory chain

NFG:

normal fasting glucose

NT:

normal triglyceride

n-VLDL:

normal VLDL

SIRT1:

sirtuin (silent mating type information regulation 2 homolog) 1

T2D:

type 2 diabetes

VLDL:

very low-density lipoprotein

References

  1. Cheng Z, Schmelz EM, Liu D, Hulver MW. Targeting mitochondrial alterations to prevent type 2 diabetes-evidence from studies of dietary redox-active compounds. Mol Nutr Food Res. 2014;58(8):1739–49.

    Article  CAS  PubMed  Google Scholar 

  2. Cheng Z, Almeida FA. Mitochondrial alteration in type 2 diabetes and obesity: an epigenetic link. Cell Cycle. 2014;13(6):890–7.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  3. Aung K, Lorenzo C, Hinojosa MA, Haffner SM. Risk of developing diabetes and cardiovascular disease in metabolically unhealthy normal-weight and metabolically healthy obese individuals. J Clin Endocrinol Metab. 2014;99(2):462–8.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  4. Cheng Z, Ristow M. Mitochondria and metabolic homeostasis. Antioxid Redox Signal. 2013;19(3):240–2.

    Article  CAS  PubMed  Google Scholar 

  5. Szendroedi J, Phielix E, Roden M. The role of mitochondria in insulin resistance and type 2 diabetes mellitus. Nat Rev Endocrinol. 2012;8(2):92–103.

    Article  CAS  Google Scholar 

  6. Lee JY, Lee DC, Im JA, Lee JW. Mitochondrial DNA copy number in peripheral blood is independently associated with visceral fat accumulation in healthy young adults. Int J Endocrinol. 2014;2014:586017.

    PubMed Central  PubMed  Google Scholar 

  7. Kaaman M, Sparks LM, van Harmelen V, Smith SR, Sjolin E, Dahlman I, et al. Strong association between mitochondrial DNA copy number and lipogenesis in human white adipose tissue. Diabetologia. 2007;50(12):2526–33.

    Article  CAS  PubMed  Google Scholar 

  8. Boyle KE, Zheng D, Anderson EJ, Neufer PD, Houmard JA. Mitochondrial lipid oxidation is impaired in cultured myotubes from obese humans. Int J Obes (Lond). 2012;36(8):1025–31.

    Article  CAS  Google Scholar 

  9. Consitt LA, Bell JA, Koves TR, Muoio DM, Hulver MW, Haynie KR, et al. Peroxisome proliferator-activated receptor-gamma coactivator-1alpha overexpression increases lipid oxidation in myocytes from extremely obese individuals. Diabetes. 2010;59(6):1407–15.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  10. Xu FX, Zhou X, Shen F, Pang R, Liu SM. Decreased peripheral blood mitochondrial DNA content is related to HbA1c, fasting plasma glucose level and age of onset in type 2 diabetes mellitus. Diabet Med. 2012;29(7):e47–54.

    Article  CAS  PubMed  Google Scholar 

  11. Ritov VB, Menshikova EV, He J, Ferrell RE, Goodpaster BH, Kelley DE. Deficiency of subsarcolemmal mitochondria in obesity and type 2 diabetes. Diabetes. 2005;54(1):8–14.

    Article  CAS  PubMed  Google Scholar 

  12. Bogacka I, Xie H, Bray GA, Smith SR. Pioglitazone induces mitochondrial biogenesis in human subcutaneous adipose tissue in vivo. Diabetes. 2005;54(5):1392–9.

    Article  CAS  PubMed  Google Scholar 

  13. Morino K, Petersen KF, Dufour S, Befroy D, Frattini J, Shatzkes N, et al. Reduced mitochondrial density and increased IRS-1 serine phosphorylation in muscle of insulin-resistant offspring of type 2 diabetic parents. J Clin Invest. 2005;115(12):3587–93.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  14. Song J, Oh JY, Sung YA, Pak YK, Park KS, Lee HK. Peripheral blood mitochondrial DNA content is related to insulin sensitivity in offspring of type 2 diabetic patients. Diabetes Care. 2001;24(5):865–9.

    Article  CAS  PubMed  Google Scholar 

  15. Antonetti DA, Reynet C, Kahn CR. Increased expression of mitochondrial-encoded genes in skeletal muscle of humans with diabetes mellitus. J Clin Invest. 1995;95(3):1383–8.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  16. Lee HK, Song JH, Shin CS, Park DJ, Park KS, Lee KU, et al. Decreased mitochondrial DNA content in peripheral blood precedes the development of non-insulin-dependent diabetes mellitus. Diabetes Res Clin Pract. 1998;42(3):161–7.

    Article  CAS  PubMed  Google Scholar 

  17. Shock LS, Thakkar PV, Peterson EJ, Moran RG, Taylor SM. DNA methyltransferase 1, cytosine methylation, and cytosine hydroxymethylation in mammalian mitochondria. Proc Natl Acad Sci U S A. 2011;108(9):3630–5.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  18. Ronn T, Poulsen P, Hansson O, Holmkvist J, Almgren P, Nilsson P, et al. Age influences DNA methylation and gene expression of COX7A1 in human skeletal muscle. Diabetologia. 2008;51(7):1159–68.

    Article  CAS  PubMed  Google Scholar 

  19. Ling C, Poulsen P, Simonsson S, Ronn T, Holmkvist J, Almgren P, et al. Genetic and epigenetic factors are associated with expression of respiratory chain component NDUFB6 in human skeletal muscle. J Clin Invest. 2007;117(11):3427–35.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  20. Pirola CJ, Gianotti TF, Burgueno AL, Rey-Funes M, Loidl CF, Mallardi P, et al. Epigenetic modification of liver mitochondrial DNA is associated with histological severity of nonalcoholic fatty liver disease. Gut. 2013;62(9):1356–63.

    Article  CAS  PubMed  Google Scholar 

  21. Lowell BB, Shulman GI. Mitochondrial dysfunction and type 2 diabetes. Science. 2005;307(5708):384–7.

    Article  CAS  PubMed  Google Scholar 

  22. Patti ME, Corvera S. The role of mitochondria in the pathogenesis of type 2 diabetes. Endocr Rev. 2010;31(3):364–95.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  23. Yu T, Robotham JL, Yoon Y. Increased production of reactive oxygen species in hyperglycemic conditions requires dynamic change of mitochondrial morphology. Proc Natl Acad Sci U S A. 2006;103(8):2653–8.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  24. Rocha M, Rovira-Llopis S, Banuls C, Bellod L, Falcon R, Castello R, et al. Mitochondrial dysfunction and oxidative stress in insulin resistance. Curr Pharm Des. 2013;19(32):5730–41.

    Article  CAS  PubMed  Google Scholar 

  25. Montgomery MK, Turner N. Mitochondrial dysfunction and insulin resistance: an update. Endocrine Connections. 2015;4(1):R1–R15.

    Article  PubMed Central  PubMed  Google Scholar 

  26. Houstis N, Rosen ED, Lander ES. Reactive oxygen species have a causal role in multiple forms of insulin resistance. Nature. 2006;440(7086):944–8.

    Article  CAS  PubMed  Google Scholar 

  27. Muoio DM, Neufer PD. Lipid-induced mitochondrial stress and insulin action in muscle. Cell Metab. 2012;15(5):595–605.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  28. Koves TR, Ussher JR, Noland RC, Slentz D, Mosedale M, Ilkayeva O, et al. Mitochondrial overload and incomplete fatty acid oxidation contribute to skeletal muscle insulin resistance. Cell Metab. 2008;7(1):45–56.

    Article  CAS  PubMed  Google Scholar 

  29. Cheng Z, Guo S, Copps K, Dong X, Kollipara R, Rodgers JT, et al. Foxo1 integrates insulin signaling with mitochondrial function in the liver. Nat Med. 2009;15(11):1307–11.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  30. Sleigh A, Raymond-Barker P, Thackray K, Porter D, Hatunic M, Vottero A, et al. Mitochondrial dysfunction in patients with primary congenital insulin resistance. J Clin Invest. 2011;121(6):2457–61.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  31. Li C, Li Y, He L, Agarwal AR, Zeng N, Cadenas E, et al. PI3K/AKT signaling regulates bioenergetics in immortalized hepatocytes. Free Radic Biol Med. 2013;60:29–40.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  32. Sleigh A, Stears A, Thackray K, Watson L, Gambineri A, Nag S, et al. Mitochondrial oxidative phosphorylation is impaired in patients with congenital lipodystrophy. J Clin Endocrinol Metab. 2012;97(3):E438–442.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  33. He J, Mao CC, Reyes A, Sembongi H, Di Re M, Granycome C, et al. The AAA+ protein ATAD3 has displacement loop binding properties and is involved in mitochondrial nucleoid organization. J Cell Biol. 2007;176(2):141–6.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  34. Holt IJ, Lorimer HE, Jacobs HT. Coupled leading- and lagging-strand synthesis of mammalian mitochondrial DNA. Cell. 2000;100(5):515–24.

    Article  CAS  PubMed  Google Scholar 

  35. Fish J, Raule N, Attardi G. Discovery of a major D-loop replication origin reveals two modes of human mtDNA synthesis. Science. 2004;306(5704):2098–101.

    Article  CAS  PubMed  Google Scholar 

  36. Maresca A, Zaffagnini M, Caporali L, Carelli V, Zanna C. DNA methyltransferase 1 mutations and mitochondrial pathology: is mtDNA methylated? Front Genet. 2015;6:90.

    Article  PubMed Central  PubMed  Google Scholar 

  37. American Diabetes Association. Consensus development conference on insulin resistance. 5–6 November 1997. Diabetes Care. 1998;21(2):310–4.

    Article  Google Scholar 

  38. Pisprasert V, Ingram KH, Lopez-Davila MF, Munoz AJ, Garvey WT. Limitations in the use of indices using glucose and insulin levels to predict insulin sensitivity: impact of race and gender and superiority of the indices derived from oral glucose tolerance test in African Americans. Diabetes Care. 2013;36(4):845–53.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  39. Wallace DC. Mitochondrial diseases in man and mouse. Science. 1999;283(5407):1482–8.

    Article  CAS  PubMed  Google Scholar 

  40. Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, et al. Sequence and organization of the human mitochondrial genome. Nature. 1981;290(5806):457–65.

    Article  CAS  PubMed  Google Scholar 

  41. Miller FJ, Rosenfeldt FL, Zhang C, Linnane AW, Nagley P. Precise determination of mitochondrial DNA copy number in human skeletal and cardiac muscle by a PCR-based assay: lack of change of copy number with age. Nucleic Acids Res. 2003;31(11), e61.

    Article  PubMed Central  PubMed  Google Scholar 

  42. Jiang WW, Masayesva B, Zahurak M, Carvalho AL, Rosenbaum E, Mambo E, et al. Increased mitochondrial DNA content in saliva associated with head and neck cancer. Clin Cancer Res. 2005;11(7):2486–91.

    Article  CAS  PubMed  Google Scholar 

  43. Wallace TM, Levy JC, Matthews DR. Use and abuse of HOMA modeling. Diabetes Care. 2004;27(6):1487–95.

    Article  PubMed  Google Scholar 

  44. Muniyappa R, Lee S, Chen H, Quon MJ. Current approaches for assessing insulin sensitivity and resistance in vivo: advantages, limitations, and appropriate usage. Am J Physiol Endocrinol Metab. 2008;294(1):E15–26.

    Article  CAS  PubMed  Google Scholar 

  45. Cheng Z, Tseng Y, White MF. Insulin signaling meets mitochondria in metabolism. Trends Endocrinol Metabol. 2010;21(10):589–98.

    Article  CAS  Google Scholar 

  46. ADA ADA. Diagnosis and classification of diabetes mellitus. Diabetes Care. 2014;37 Suppl 1:S81–90.

    Google Scholar 

  47. Brunzell JD, Davidson M, Furberg CD, Goldberg RB, Howard BV, Stein JH, et al. Lipoprotein management in patients with cardiometabolic risk: consensus statement from the American Diabetes Association and the American College of Cardiology Foundation. Diabetes Care. 2008;31(4):811–22.

    Article  CAS  PubMed  Google Scholar 

  48. Mengel-From J, Thinggaard M, Dalgard C, Kyvik KO, Christensen K, Christiansen L. Mitochondrial DNA copy number in peripheral blood cells declines with age and is associated with general health among elderly. Hum Genet. 2014;133(9):1149–59.

    Article  CAS  PubMed  Google Scholar 

  49. Bellizzi D, D’Aquila P, Scafone T, Giordano M, Riso V, Riccio A, et al. The control region of mitochondrial DNA shows an unusual CpG and non-CpG methylation pattern. DNA Res. 2013;20(6):537–47.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  50. Kushner RF, Ryan DH. Assessment and lifestyle management of patients with obesity: clinical recommendations from systematic reviews. JAMA. 2014;312(9):943–52.

    Article  CAS  PubMed  Google Scholar 

  51. Temelkova-Kurktschiev T, Stefanov T. Lifestyle and genetics in obesity and type 2 diabetes. Exp Clin Endocrinol Diabetes. 2012;120(1):1–6.

    Article  CAS  PubMed  Google Scholar 

  52. Iacobazzi V, Castegna A, Infantino V, Andria G. Mitochondrial DNA methylation as a next-generation biomarker and diagnostic tool. Mol Genet Metab. 2013;110(1–2):25–34.

    Article  CAS  PubMed  Google Scholar 

  53. Aloni Y, Attardi G. . Expression of the mitochondrial genome in HeLa cells. II. Evidence for complete transcription of mitochondrial DNA. J Mol Biol. 1971;55(2):251–67.

    Article  CAS  PubMed  Google Scholar 

  54. Curradi M, Izzo A, Badaracco G, Landsberger N. Molecular mechanisms of gene silencing mediated by DNA methylation. Mol Cell Biol. 2002;22(9):3157–73.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  55. de Kreutzenberg SV, Ceolotto G, Papparella I, Bortoluzzi A, Semplicini A, Dalla Man C, et al. Downregulation of the longevity-associated protein sirtuin 1 in insulin resistance and metabolic syndrome: potential biochemical mechanisms. Diabetes. 2010;59(4):1006–15.

    Article  PubMed Central  PubMed  Google Scholar 

  56. O’Hagan HM, Wang W, Sen S, Destefano Shields C, Lee SS, Zhang YW, et al. Oxidative damage targets complexes containing DNA methyltransferases, SIRT1, and polycomb members to promoter CpG Islands. Cancer Cell. 2011;20(5):606–19.

    Article  PubMed Central  PubMed  Google Scholar 

  57. O’Hagan HM, Mohammad HP, Baylin SB. Double strand breaks can initiate gene silencing and SIRT1-dependent onset of DNA methylation in an exogenous promoter CpG island. PLoS Genet. 2008;4(8), e1000155.

    Article  PubMed Central  PubMed  Google Scholar 

  58. Peng L, Yuan Z, Ling H, Fukasawa K, Robertson K, Olashaw N, et al. SIRT1 deacetylates the DNA methyltransferase 1 (DNMT1) protein and alters its activities. Mol Cell Biol. 2011;31(23):4720–34.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  59. The NS, Richardson AS, Gordon-Larsen P. Timing and duration of obesity in relation to diabetes: findings from an ethnically diverse, nationally representative sample. Diabetes Care. 2013;36(4):865–72.

    Article  PubMed Central  PubMed  Google Scholar 

  60. Stump CS, Short KR, Bigelow ML, Schimke JM, Nair KS. Effect of insulin on human skeletal muscle mitochondrial ATP production, protein synthesis, and mRNA transcripts. Proc Natl Acad Sci U S A. 2003;100(13):7996–8001.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  61. Boirie Y, Short KR, Ahlman B, Charlton M, Nair KS. Tissue-specific regulation of mitochondrial and cytoplasmic protein synthesis rates by insulin. Diabetes. 2001;50(12):2652–8.

    Article  CAS  PubMed  Google Scholar 

  62. Bogacka I, Ukropcova B, McNeil M, Gimble JM, Smith SR. Structural and functional consequences of mitochondrial biogenesis in human adipocytes in vitro. J Clin Endocrinol Metab. 2005;90(12):6650–6.

    Article  CAS  PubMed  Google Scholar 

  63. Gurd BJ, Perry CG, Heigenhauser GJ, Spriet LL, Bonen A. High-intensity interval training increases SIRT1 activity in human skeletal muscle. Appl Physiol Nutr Metabol. 2010;35(3):350–7.

    Article  CAS  Google Scholar 

  64. Balkau B, Mhamdi L, Oppert JM, Nolan J, Golay A, Porcellati F, et al. Physical activity and insulin sensitivity: the RISC study. Diabetes. 2008;57(10):2613–8.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  65. Almeida FA, Pardo KA, Seidel RW, Davy BM, You W, Wall SS, et al. Design and methods of “diaBEAT-it!”: a hybrid preference/randomized control trial design using the RE-AIM framework. Contemp Clin Trials. 2014;38(2):383–96.

    Article  PubMed  Google Scholar 

  66. Zhang FF, Santella RM, Wolff M, Kappil MA, Markowitz SB, Morabia A. White blood cell global methylation and IL-6 promoter methylation in association with diet and lifestyle risk factors in a cancer-free population. Epigenetics. 2012;7(6):606–14.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  67. Michels KB, Harris HR, Barault L. Birthweight, maternal weight trajectories and global DNA methylation of LINE-1 repetitive elements. PLoS One. 2011;6(9), e25254.

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  68. Sookoian S, Rosselli MS, Gemma C, Burgueno AL, Fernandez Gianotti T, Castano GO, et al. Epigenetic regulation of insulin resistance in nonalcoholic fatty liver disease: impact of liver methylation of the peroxisome proliferator-activated receptor gamma coactivator 1alpha promoter. Hepatology. 2010;52(6):1992–2000.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We are grateful to Drs. Carlos J. Pirola and Silvia C. Sookoian for their assistance with MSP assay. Funding for this work was provided, in part, by the Virginia Agricultural Experiment Station and the Hatch Program of the National Institute of Food and Agriculture, U.S. Department of Agriculture (Z.C. and F.A.A.) and NIH grant 5R18DK091811-02 (F.A.A.). Publication of this article was supported by Virginia Tech's Open Access Subvention Fund.

Author information

Authors and Affiliations

Authors

Corresponding authors

Correspondence to Fabio A. Almeida or Zhiyong Cheng.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

The study was conceived and designed by ZC and FAA. Participant recruitment was conducted by SSW, LEL, MHG, RWS, PAE, and FAA. The experiments were performed by LDZ, LEL, ZC, and LL. Data were analyzed by LDZ, LEL, ZC, and FAA. The paper was written by ZC, LDZ, and FAA in communication with MHG, RWS, and PAE. All authors read and approved the final manuscript.

Additional files

Additional file 1: Figure S1.

Scatter plot of the measurements and demographic characteristics of lean (n = 8) and obese (n = 32) participants in this study. The middle lines indicate the mean values, and the other two shorter lines indicate SE *p < 0.05; **p < 0.001; ***p < 0.0001.

Additional file 2: Figure S2.

Age-matched analysis of mtDNAn in lean (n = 7) and obese (n = 8) participants. (A) No significant difference existed between the ages of lean (n = 7) and obese (n = 8) participants. (B) Comparison of mtDNAn between lean (n = 7) and obese (n = 8) participants. The data were presented as mean ± SE. *p < 0.05; NS, not significant.

Additional file 3: Figure S3.

Regression analyses of mtDNAn with metabolic parameters and demographic characteristics (n = 40). These graphs correspond to the analysis and data shown in Table 2.

Rights and permissions

Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.

The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.

To view a copy of this licence, visit https://creativecommons.org/licenses/by/4.0/.

The Creative Commons Public Domain Dedication waiver (https://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Zheng, L.D., Linarelli, L.E., Liu, L. et al. Insulin resistance is associated with epigenetic and genetic regulation of mitochondrial DNA in obese humans. Clin Epigenet 7, 60 (2015). https://doi.org/10.1186/s13148-015-0093-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13148-015-0093-1

Keywords