Fig. 3From: Histone deacetylase 3 deletion in alveolar type 2 epithelial cells prevents bleomycin-induced pulmonary fibrosisTGF-β1/SMAD3 signaling upregulates HDAC3 transcription. A Representative images showing immunohistochemical staining of TGF-β1 in saline-treated and BLM-treated mice at day 21. (× 200, n = 5). B The relative mRNA level of TGF-β1 in lung tissues from BLM-treated mice at day 21. (n = 5). C The relative mRNA level of HDAC3 in TGF-β1-treated primary mouse AT2 cells at 0, 24, 48, 72 h. (n = 5). D Representative images of HDAC3 immunofluorescence staining and quantitation in AT2 cells after TGF-β1 stimulation at 72 h. (× 1000, n = 5). E HDAC3 activity in AT2 cells after PBS or TGF-β1 treatment (10 ng/ml for 72 h). (n = 5). F Representative Western blot images and the corresponding quantitative results for HDAC3, phosphorylated-SMAD3 (p-SMAD3) and SMAD3 in TGF-β1-treated primary mouse AT2 cells at 0, 24, 48, 72 h. (n = 5). G, H mRNA and protein expression of HDAC3 after SB431542 inhibited TGF-βRI in AT2 in the presence of DMSO or TGF-β1 for 72 h. (n = 5) (SB431542 was administered half an hour before TGF-β1 or DMSO). I, J The mRNA and protein level of HDAC3 after SIS3 inhibited the phosphorylation of SMAD3 in AT2 in the presence of DMSO or TGF-β1 for 72 h. (n = 5; SIS3 was administered half an hour before TGF-β1 or DMSO). K Chromatin immunoprecipitation assay showing SMAD3 and the HDAC3 promoter with or without SMAD3 overexpression in AT2 cells. (n = 5). L Quantitation of HDAC3 via luciferase assay. AT2 cells were transfected with the normal murine HDAC3 promoter reporter plasmid (CAGCGAGCCCAGACATCTCGCTTGA) and mutant HDAC3 promoter reporter plasmid (CAGCGAGCCCAGCACTCTCGCTTGA) as a negative control plus a renilla luciferase plasmid. Then, AT2 cells were treated with TGF-β1 (10 ng/ml) and/or SIS3 (10 μM) for 72 h and luciferase activities measured and normalized with renilla luciferase activities(n = 5). (*P < 0.05, **P < 0.01, ***P < 0.001, nsP > 0.05)Back to article page