Fig. 2

Repeat sequence content and polymerase kinetics using PacBio HiFi sequencing. a Waterfall plots showing complete repeat structure of non-expanded, pathogenic and non-pathogenic expanded alleles excised by the CRISPR/Cas9-based enrichment method (No-Amp) in patients and their asymptomatic fathers. Y-axis shows the number of circular consensus sequence (CCS) reads, whereas the X-axis shows the length of the repeat expansions in bases. GGC, GGA and ACCGAGAAGATGCCCGCCCTGC sequences are shown as blue, orange and green short longitudinal lines, respectively. b Upper line shows cas9-targeted region with RefSeq and repeatmasker annotation from UCSC genome browser (https://genome.ucsc.edu/). Lower graphs show polymerase kinetics of non-expanded and expanded alleles for each allele during the SMRT sequencing. x-axis: cumulative replication cycle time; y-axis: numbers represent the base pair position within cas9-excised DNA fragment for each allele (allele position). Allele 1: non-expanded allele; Allele 2: expanded allele of patients and their fathers or second non-expanded allele of the F1-mother and F2-mother. Unphased non-expanded alleles of the F3-mother and F4-mother are displayed in allele 1 because the two non-expanded alleles had similar repeat sizes and could not be separated. Pt patient; Fa father; Mo mother. Magenta, black, green, blue and yellow rectangles represent crRNAs, (GGC)n/(GGCGGA)n, CpG island, SINE and LINE repetitive elements, respectively