Skip to main content

Table 4 Sequences of the primers used and annealing temperature for each gene

From: Epigenetic landscape of testis specific histone H2B variant and its influence on sperm function

Gene Forward primer Reverse primer Annealing temp. (°C)
CREM CCACATTACTGAATATGGGTGCT TTTCTAAGTGCAGAAACATGCCT 58
CDYL GGACTTCAAAGTTGGGGGCA GAGGGTCTGTCAGCTTGTGA 60
PRKAG2 TGAGCCTTCAGTGAGTGGTA CCATCCTAACCTTCAGGAAGCA 60
CATSPERB GCACCGTATGGTGTGGACTA CCCTCCAGACAAAGCACCAT 60
TSGA10 GGTGTCTGCTAATTGCCAGGT GATAGGAGGTTTGGGCCACG 60
TSSK1B CCAACGGGATCTTGCTGAAC AGCATATCCATACGCAGAACCAT 62