Skip to main content

Table 1 Primer sequences

From: Transgenerational inheritance of fetal alcohol exposure adverse effects on immune gene interferon-ϒ

Primer Name Sequence
Ifn-ɣ FP 5’ AAAGACAACCAGGCCATCAGCAAC 3’
Ifn-ɣ RP 5’ TCTGTGGGTTGTTCACCTCGAACT 3’
Ifn-ɣ BSP FP 5’ TTATAAGAATGGTATAGGTGGGTA 3’
Ifn-ɣ BSP RP 5’ -/5Bio/-AACTAATATATCTTCTCTAAATCAACC 3’
Ifn-ɣ seq FP 5’ TTATAAGAATGGTATAGGTG 3’
Gapdh FP 5’ AGACAGCCGCATCTTCTTGT 3’
Gapdh RP 5’ CTTGCCGTGGGTAGAGTCAT 3’
18S FP 5’ GTAACCCGTTGAACCCCATT 3’
18S RP 5’ CCATCCAATCGGTAGTAGCG 3’
Rpl-19 FP 5’ AATCGCCAATGCCAACTCTCG 3’
Rpl-19 RP 5’ TGCTCCATGAGAATCCGCTTG 3’
  1. FP forward primer, BSP FP bisulfite sequencing forward primer, BSP RP bisulfite sequencing reverse primer, 5Bio 5’end biotin labeled, seq FP sequencing forward primer