Skip to main content

Table 5 Primers sequences in the promoter region of Mouse Dleu2

From: Suv39h1 promotes facet joint chondrocyte proliferation by targeting miR-15a/Bcl2 in idiopathic scoliosis patients

Primers Sequence (5′–3′) Length (bp)
Primer 1 F: TAGGCTCGGACAGGTTATCC 227
  R: GGGAGAGGGAGGTAGAAGTT  
Primer 2 F: AAGGCTCTCTACTTCCTCGG 203
  R: CGGTGGCTTGGAGTTTAGT  
Primer 3 F: TAAACTCCAAGCCACCGAG 169
  R: GGTCGTGTGATTGAACCGT  
  1. Abbreviation: F forward, R reverse