Skip to main content

Advertisement

Table 2 Primers sequences for genes

From: Suv39h1 promotes facet joint chondrocyte proliferation by targeting miR-15a/Bcl2 in idiopathic scoliosis patients

GENE Primer sequence (5′–3′) Length (bp)
H-ACAN F: ACCGCATCTAATTTGTCCGC 201
  R: AACGATTGCACTGCTCTTGG  
H-COL2A1 F: CATCCCACCCTCTCACAGTT 166
  R: GGGCATTTGACTCACACCAG  
H-GAPDH F: TGACCCCTTCATTGACCTCA 166
  R: ATCGCCCCACTTGATTTTGG  
H-COL10A1 F: AAGGGAGAAAGAGGACCTGC 180
  R: TGGCCCTGTCTCACCTTTAG  
H-SUV39H1 F: TTTGCCACAAGAACCATCCG 183
  R: GTATTTGCGGCAGGACTCAG  
H-SUV39H2 F: TCGTCTTCCCCGAATAGCAT 169
  R: GCAAGTCACAGCTCCACATT  
H-BCL2 F: CAAGTGTTCCGCGTGATTGA 153
  R: CAGAGGAAAAGCAACGGGG  
H-BAX F: GTGCCGGAACTGATCAGAAC 162
  R: CCAAAGTAGGAGAGGAGGCC  
H-DLEU2 F: GAGACCTCTACTTAGCTCAGCA 232
  R: TGCTATGCCAACTTAACAGGG  
M-Dleu2 F: TCTCTCGGGCAGAAACCTAC 219
  R: TCGTTTGTGTGCTCTGGAAG  
M-Col2a1 F: CAACACAATCCATTGCGAAC 159
  R: TCTGCCCAGTTCAGGTCTCT  
M-Col10a1 F: CAAGCCAGGCTATGGAAGTC 154
  R: AGCTGGGCCAATATCTCCTT  
M-Bcl2 F: CACACACACACATTCAGGCA 154
  R: GGCAATTCCTGGTTCGGTTT  
M-Bax F: GGATGATTGCTGACGTGGAC 175
  R: ATGGTTCTGATCAGCTCGGG  
M-Gapdh F: CCCACTCTTCCACCTTCGAT 181
  R: CTTGCTCAGTGTCCTTGCTG  
  1. Abbreviation: F forward, R reverse, H human, M mouse