Skip to main content

Table 6 Primer list for RT-qPCR

From: Increased methylation upstream of the MEG3 promotor is observed in acute myeloid leukemia patients with better overall survival

Gene Forward primer (5′-3′) Reverse primer (5′-3′)
DLK1 GCGAGGATGACAATGTTTGCA GGTTCTCCACAGAGTCCGTGAA
MEG3 ATCCCGGACCCAAGTCTTCT CCACATTCGAGGTCCCTTCC
B2M TGACTTTGTCACAGCCCAAGATA AATGCGGCATCTTCAAACCT