Skip to main content

Table 2 Primer list for PCR of BSgDNA

From: Increased methylation upstream of the MEG3 promotor is observed in acute myeloid leukemia patients with better overall survival

Locus 1st PCR primer pair (5′-3′) 2nd PCR primer air (5′-3′)
IGF2-H19 ICR F–AGGTGTTTTAGTTTTATGGATGATGG [47]
R–TCCCATAAATATCCTATTCCCAAATAACC [47]
F–TGTATAGTATATGGGTATTTTTGGAGGTTT [47]
R–TCCCATAAATATCCTATTCCCAAATAACC [47]
DLK1-MEG3 IG-DMR (CG6) F–TGGGAATTGGGGTATTGTTTATAT
R–AAACAATTTAACAACAACTTTCCTC
F–GTTAAGAGTTTGTGGATTTGTGAGAAATG [39]
R–CTAAAAATCACCAAAACCCATAAAATCAC [39]
MEG3 DMR (CG7) F–TTATTTTTTTGAATAATAAGAGAAAGTATG
R–CTCATTTCTCTAAAAATAATTAACC
F–TTATTTTTTTGAATAATAAGAGAAAGTATG R–CCCCAAATTCTATAACAAATTACT [39]
MEG3 promotor (CG9) F–TGAGGAAGTAGGGGTTTATAGAGAG
R–AACCCTACAACCCCACAAAA [39]
F–GGAGAGTGGGGTTTATTGTGAA [39]
R–AACCCTACAACCCCACAAAA [39]
MEG3 intragenic (CG8) F–GTTTGAGATTTGTTGGGTATTT [39]
R–AATTTAACTAACAAATCACAAATATTAACT
F–GTTTGAGATTTGTTGGGTATTT [39]
R–AATTTAACTAACAAATCACAAATATTAACT
ZAC DMR F–GGGGTAGTYGTGTTTATAGTTTAGTA [48]
R–CRAACACCCAAACACCTACCCTA [48]
F–GGGGTAGTYGTGTTTATAGTTTAGTA [48]
R–CRAACACCCAAACACCTACCCTA [48]
PEG1 DMR F–TTGTTGGTTAGTTTTGTAYGGTT [47]
R–AAAAATAACACCCCCTCCTCAAAT [47]
F–TTGTTGGTTAGTTTTGTAYGGTT [47]
R–CCCAAAAACAACCCCAACTC [47]
PEG3 DMR F–AAAAGGTATTAATTATTTATAGTTTGGT [49]
R–AAAAATATCCACCCTAAACTAATAA [49]
F–AAAAGGTATTAATTATTTATAGTTTGGT [49]
R–AAAAATATCCACCCTAAACTAATAA [49]