Skip to main content

Table 2 List of primer sequences used for real-time PCR to quantify the ChIP-assays

From: Differential open chromatin profile and transcriptomic signature define depot-specific human subcutaneous preadipocytes: primary outcomes

Gene Forward Reverse
HOTAIR (−329) GTGAGCTCGCGGCATTTTTA GCATTTTCGACCCAGGCATC
HOXA3 (− 313) GGGGGTAGGGAGGAATTTGC CCTGACCCCCAAGAACTCAC
HOXA5 (− 398) TGGCTAAATGGCTTTCCCCC CCGTTTTGCAGCCCCTCTTA
HOXC13 (+ 42) CCAATCCAGAGACTTCAGGA GAGGAGAGCGCTGTAACTG