Skip to main content

Table 1 Primers designed for multiplex PCR

From: Vitamin D and the promoter methylation of its metabolic pathway genes in association with the risk and prognosis of tuberculosis

Gene Fragment Forward primer Reverse primer
CYP24A1 CYP24A1 _1 TAGAGGAGGGYGGAGTGGTTT CACACCCRATAAACTCCRAACTTC
CYP24A1 _2 GGAGATAATTTTTAGGAAGTTATGYGAAGTT CACTTCAATCCAAACTAAAAATATCTAACTC
CYP27A1 CYP27A1 _1 TTGGTTTYGTGGGGGTAGAG CACCRCRTCCCTCTCCTACAA
CYP27A1 _2 GGAGGGTYGAGTAAAGGTTAGTTAGAT AAAACCTATCCCRATATAAAACTTCC
CYP27A1 _3 ATTTTGGGYGGGGGTGTAG CCCTCCAAAAATCAAATAACTAACC
CYP27A1 _4 TTTTYGGATTGATTTYGGAGTTAGT ACTATACRTTTTCCRTACTATATTACTCTTTCC
CYP27A1 _5 GGTTGAGATTAGATTTYGTAGATGATG ACCAACTATACCATCCTACTAAATCCT
CYP27B1 CYP27B1 _1 GGTTGAGATATGATGTTTAGGAGAAG TCCCTTCCTACCTACAACTCRTATA
CYP27B1 _2 TTTGGYGTGGGTATAGGTTAAGTTG CTCACRCAATAAACAATCCRCAAAC
CYP27B1 _3 GAGTTGTTGYGATAGGAGGGATT CAACCRACCTCCCACCA
CYP2R1 CYP2R1 _1 TTAATGGGAGTATGGTAGGGTTG AAAAACCCATCRACCRCCTCTA
CYP2R1 _2 GGTAGGGAGGGTYGTTAGGTTG CAAAACTAAATCRCCTCRAAACCTC
CYP2R1 _3 TGTAGGGGGAGTTTYGTTTTTGT CAAACACCRAAAAACCTACTATTAACC
CYP2R1 _4 GGAAAATTAAGGYGTTTTGAGTTTTA CACACAAAAAACRCCTTTTAAATATCTAC
VDR VDR _1 GTAGTTATTTATAATTTTAGGTTTTAGGAGGTAG CTCAACCTAATCCCACAAATTAAAA
VDR _2 AGGTGATATYGGGTGGGAGTAAT CCACCTAAACTAACCAAACCAA
VDR _3 GGTGTTAGTYGGTAGGYGTTTTTTAG CATAAAACAAAACACRCTTCTACCCT
VDR _4 TTTYGATTAATATAGGTTGAAGYGGGTA CCCACAAATCCAATCCTCTC
VDR _6 GAATTYGGGAGTAGYGGGAAAG TACTAAACACTATATTAACRAAACATTTCTCC