Skip to main content

Table 1 Candidate genes and amplicons for VSMC bisulphite NGS: Genomic locations, primer sequences, annealing temperatures and CpG coverage are displayed for each amplicon targeting candidate genes

From: SMYD2 promoter DNA methylation is associated with abdominal aortic aneurysm (AAA) and SMYD2 expression in vascular smooth muscle cells

Gene symbol Chromosome and RefSeq ID RefSeq ID coordinates Primer sequence 5′-3’ Annealing temp (°C) CpG coverage
LRP1   3875–4240 F: TAGAAGGGGGTAGTGATTAAAAGTA 54 13
  R: AAAACAAACCCTAATTTAAAAAAAA
Chr: 12 4274–4640 F: GGGTATTAAGGTGGGTTTTATTTT 57 25
NG_016444.1 R: TACTCTAAAATTTCAAACTCCCTCC
  4680–5036 F: GTATTAGGGAGGAGGGTTTAGTTAG 54 24
  R: TCCTCAATACATAAACCTAAAACTC
ERG   282787–283319 F:TTTTATTAGGTAGTGGTTAGATTTAGTTTT 54 22
Chr: 21 R: TACCCCCAATTAATAAATTCCAATATA
NG_029732.1 283331–283680 F: TTGGAATTTATTAATTGGGGGTATATAT 57 6
  R: ACACTATCTTTTACAAAATCAATCCAC
  5162–5540 F: AAAATTTTTGGAAGGGGTTTAGTT 56 37
  R: ATAATATTTTTCCAACCTCATTAAAAAC
MMP-9   3980–4579 F: TTGGGTTTAAGTAATTTTTTTATTT 52 7
Chr: 20 R: TAACCCATCCTTAACCTTTTACAAC
NG_011468.1 4640–5600 F: GATGGGGGATTTTTTTAGTTTTATT 57 8
  R: TACCCATTTCTAACCATCACTACTC
LDLR   4376–4725 F: TTTTTTAAGGGGAGAAATTAATATTTA 54 5
  R: CACAAAAAAATAACAACAACCTTTC
  4776–5355 F: GAAAGGTTGTTGTTATTTTTTTGTG 57 28
Chr: 19 R: AAACTCCCTCTCAACCTATTCTAAC
NG_009060.1 5464–5972 F: TTTAAGTTTTTATAGGGTGAGGGAT 56 31
  R: ACACCCAACTCAAAATAACAATAAC
  6054–6785 F: AATTTTATTGGGTGTAGTTTAATAGGTTAT 54 49
  R: CTCAAAATCATACACTAACCAACCTC
IL6R   2781–3061 F: TTTTTGTTTAGGTTGGAGTGTAGTG 52 8
Chr: 1 R: CAAAATTTTAATATTATAATTCACATAAAA
NG_012087.1 3095–3729 F: GTTTGTTTTGGTGTAGAGATAGGTG 58 7
  R: ATAAAACTCCCAAATAAACAAAACC
SORT1 Chr: 1 4363–4804 F: AGATTATTTTTTAGGTTTGTAGGAGTTA 55 24
NG_028280.1 R: AACAAAAACTACTAAAATCAACCCC
SMYD2   214280141–214280630 F: TTTTATTTTGAAGTAGTGGTTTTTGTTAA 55 13
  R: TTTTCCAAAATTAAAAATTTTTAAACCT
Chr: 1 214280631–214281330 F: AAGGTTTAAAAATTTTTAATTTTGGAAA 58 82
NC_000001.11 R: AAATCCCCCACCTAAAAAAACTAC
  214281331–214281733 F: TTTTTTTAGGTGGGGGATTT 55 46
  R: CCCACATTTAAAAACAAAAACCTAC
SERPINB9   2891544–2892079 F: GGTGTTGAAAATATTTTTGGAGGTA 57 26
  R: AAAATCTACCATTCATCAAACTAACAAA
  2890564–2891263 F: TTAGAGGGTGGGATTAGAGGTAGTT 54 9
Chr: 6 R: TTTCCACCTAAAAAACCAAAATTAA
NC_000006.12 2889934–2890423 F: GTATTTGGGAATTGTTGATGTTTTT 55 11
  R: ACAACAAAAAATCATTATAATCTATTTTCT
  2889425–2889933 F: AGAATTTTATATGTAATTTATTTTGG 54 31
  R: TATAATCCCAACACTTTAAAAAACC
DAB2IP   121689899–121690502 F: TTGGAGTAGTTTGTTTGTTGTGTT 57 10
  R: TAAAAAATTAAATACCCAAAACCTC
  121690573–121691062 F: TTGTTATATTTTAAGTTGAGATTTTGGG 57 6
Chr: 9 R: TAACCACATAAAAACATTCCAAACA
NC_000009.12 121767430–121767872 F: GGAGAGGAGATAGGAAAGTTTTTAG 57 6
  R: CTAACCTTATCCCTTACAACCACTAC
  121768273–121768692 F: AATGGAGTGGGAGTTTGTTATAGTG 57 11
  R: TAATAACAACTTTTAACCCCACCTC