Skip to main content

Table 2 The primer sequences used for high-resolution melting real-time PCR analysis

From: Differences in DNA methylation profile of Th1 and Th2 cytokine genes are associated with tolerance acquisition in children with IgE-mediated cow’s milk allergy

Primers Sequence (5′-3′) PCR product size (bp) CpG sites ( n )
IL-4 F AGGTTAGGAGATGGAGATTATTTTG 102 4
IL-4 R TAAAACTACAAACACCTACCACCAC   
IL-5 F AGGTTAGGAGATGGAGATTATTTTG 102 5
IL-5 R TAAAACTACAAACACCTACCACCAC   
IFN-γ F GAGTTTTGTTTTGTTATTTAGGTTGG 124 6
IFN-γ R AATACCTATAATCCCAACTACTC   
IL-10 F TTTATTGTGTTAATTAGGATGGTTT 154 7
IL-10 R TAAACAAAAATCCAAAATACTTTTT   
\