Skip to main content

Table 1 Three candidate genes with differential methylation between low and high DEHP exposure in the screening

From: Effects of phthalate exposure on asthma may be mediated through alterations in DNA methylation

Gene gene ID CpG island location Assay details b
TSS position Met% a (mean ± SD) of low and high DEHP exposure
AR (androgen receptor) (367) ChrX: 66763684-66764077 Catalog number: 335002 EPHS115070-1A
SABiosciences CpG Island ID: 115070
CpG island location: ChrX: 66763684-66764077
Assay position (central point): ChrX: 66763921
PCR product size: 171
NCBI build number: 37
66763873 Low vs. high exposure:
 35.73 ± 31.76 vs. 14.95 ± 17.23
P = 0.071 by qPCR
TNFα (tumor necrosis factor α) 7124) Chr6: 31543344-31544344 Catalog number: 335002MePH80050-1A
SABiosciences CpG Island ID: custom design
CpG island location: Chr6: 31543344-31544344
Assay position (central point): Chr6: 31543573
PCR product size: 294
(The sequence is in the Supplement)
NCBI build number: 37
31543350 Low vs. high exposure:
 42.65 ± 26.36 vs. 35.61 ± 27.13
P = 0.036 by qPCR
IL-4 (Interleukin-4) (16189) Chr5: 132035956-132036176 Pyrosequence primer info:
 F:GTTGATTGGTTTTAAGTGATTGATAATT
 R:Biotin-ATACCAAATAAATACTCACCTTCTACT
 S:TTTTTGTTTTTTTTGTTAGTATGT
Sequence to analysis:
 GTYGGTAATTTTGTTTAYGGATATAAGTGYGATATTATTTTATAGGAGATTATTA
132040541 Low vs. high exposure:
 89.36 ± 3.58 vs. 89.36 ± 7.56
P = 0.249 by pyrosequencing
  1. aMet%: percentage of methylated cytosine in the CGIs; b AR and TNFα results were identified by EpiTect Methyl II qPCR assay. Since there was no commercial kit for IL-4 DNA methylation by qPCR, IL-4 results were obtained by pyrosequencing method via QIAGEN PyroMark Q24 instrument.