From: Effects of phthalate exposure on asthma may be mediated through alterations in DNA methylation
Gene gene ID | CpG island location | Assay details b |
---|---|---|
TSS position | Met% a (mean ± SD) of low and high DEHP exposure | |
AR (androgen receptor) (367) | ChrX: 66763684-66764077 | Catalog number: 335002 EPHS115070-1A |
SABiosciences CpG Island ID: 115070 | ||
CpG island location: ChrX: 66763684-66764077 | ||
Assay position (central point): ChrX: 66763921 | ||
PCR product size: 171 | ||
NCBI build number: 37 | ||
66763873 | Low vs. high exposure: | |
35.73 ± 31.76 vs. 14.95 ± 17.23 | ||
P = 0.071 by qPCR | ||
TNFα (tumor necrosis factor α) 7124) | Chr6: 31543344-31544344 | Catalog number: 335002MePH80050-1A |
SABiosciences CpG Island ID: custom design | ||
CpG island location: Chr6: 31543344-31544344 | ||
Assay position (central point): Chr6: 31543573 | ||
PCR product size: 294 | ||
(The sequence is in the Supplement) | ||
NCBI build number: 37 | ||
31543350 | Low vs. high exposure: | |
42.65 ± 26.36 vs. 35.61 ± 27.13 | ||
P = 0.036 by qPCR | ||
IL-4 (Interleukin-4) (16189) | Chr5: 132035956-132036176 | Pyrosequence primer info: |
F:GTTGATTGGTTTTAAGTGATTGATAATT | ||
R:Biotin-ATACCAAATAAATACTCACCTTCTACT | ||
S:TTTTTGTTTTTTTTGTTAGTATGT | ||
Sequence to analysis: | ||
GTYGGTAATTTTGTTTAYGGATATAAGTGYGATATTATTTTATAGGAGATTATTA | ||
132040541 | Low vs. high exposure: | |
89.36 ± 3.58 vs. 89.36 ± 7.56 | ||
P = 0.249 by pyrosequencing |