Skip to main content

Table 2 NOMe-seq primer sequences and amplification conditions

From: Nucleosome positioning is unaltered at MLH1 splice site mutations in cells derived from Lynch syndrome patients

Region NOMe-seq primers Annealing (°C)
c.588 + 1G > T F:TTGATATTTAGTGTGTGTTTTTGGYAAT F/R = 54°C
R:CACATAATATCTTAAAAAATTCCAAAATAATA F/RN = 56°C
RN:ATACCRACTAACARCATTTCCAAAAATAA
c.589-2A > G F:TTAGGTATTTAGTATATAATGYAGG F/R = 51°C
R:CACTATAAATATTTTCAAAACTAAAACCTTA F/RN = 52°C
RN:CACAAAATCTAAAAAATTACATACACCTAA  
c.790 + 1G > T F:TAGGYATAGGAGGATTTTAAATGGATTAAGTT F/R = 52°C
R:CAATTTCTTTAATAACAATRCCTATACCTAAA F/RN = 52°C
RN:TTACTCRTAAAAACTCTAACACCATCAA
c.791-1G > C F:GATGTGATGTGYATATTATTATAGAAATGTT F/R = 55°C
R:TATCARCACCTCCTAATAAAATGAARCATA F/RN = 56°C
RN:ATCCTTTTRCCAATAATATATAAAATTCACTCTA
c.884G > A F:GGATGTGATGTGYATATTATTATAGAAATGTT F/R = 58°C
R:CTATTATARCTTCCCAACTAACCCCARCAA F/RN = 58°C
RN:CTACAARCTATCARCACCTCCTAATAA
c.1559-2A > T F:TATTAGGAGGYTTAATTTAGGYTTTTTTGYTTAT F/R = 58°C
R:ACCCTCACCACCTAATTCACAACATTTATAA F/RN = 57°C
RN:ACTAARCAACTACCAAAAACTAARCTTCTTA
HSPA5 F: GAGAAGAAAAAGTTTAGATTTTATA F/R = 56°C
R: AAACACCCCAATAAATCAATC