Skip to main content

Table 2 The primers sequence information for Bisulfite Pyrosequencing

From: Alterations of DNA methylation were associated with the rapid growth of cortisol-producing adrenocortical adenoma during pregnancy

Primers name Primer sequence (5′–3′) 5′ modification
CG06542648-F(242 bp) AGAATTAAGAATTGTGGGTTTAGG  
CG06542648-R(Q48) CCACCCCCAAAACTTAATCTAACCAAAA 5′-Biotin
CG06542648-S GGGAGTTGAGGTAATAGAG  
CG13307058-F(104 bp) GTAGAAGGTAGGGAAGAGAGG  
CG13307058-R(Q96) TCCCAAACATCCCCCAAC 5′-Biotin
CG13307058-S GGAAGAGAGGGAAGT  
CG20106776-F(175 bp) AGAGTTTTTAGGATTTTAGTAGAATTAGT  
CG20106776-R(Q96) TCTCCCAATATACCCTACCTACACCTATAC 5′-Biotin
CG20106776-S AGATTTTTATTGTGGTGG  
CG15323015-F(151 bp) ATTAGAGAGTGGGAAGGGTAGT  
CG15323015-R(Q96) TTACCCCTCTTCTAAACCCAACCTT 5′-Biotin
CG15323015-S AGGGGAGTTATTATGAG