Skip to main content

Table 1 List of bisulfite PCR primers

From: Assessment of MGMT methylation status using high-performance liquid chromatography in newly diagnosed glioblastoma

  Primer sequence (5′–3′) Amplicon size (bp)
Region 1 F: GGTAAATTAAGGTATAGAGTTTTAGG 198
R: AAAACCTAAAAAAAACAAAAAAAC
Region 2 F: GGTTTGGGGGTTTTTGATTAG 294
R: CCTTTTCCTATCACAAAAATAATCC
Region 3 F: GGATATGTTGGGATAGTT 259
R: ACAACACCTAAAAAACACTTAAAAC