Skip to main content

Table 1 List of primers used in this study

From: The tumor suppressor Zinc finger protein 471 suppresses breast cancer growth and metastasis through inhibiting AKT and Wnt/β-catenin signaling

PCR Primer Sequence (5′-3′) Product Size (bp) PCR cycles Annealing temperature (°C)
RT-PCR ZNF471F GAGATGACGAGTGAGATGAC 194 32 55
ZNF471R TGACTTCCCATCTGCTTCTC    
GAPDHF GGAGTCAACGGATTTGGT 206 23 55
GAPDHR GTGATGGGATTTCCATTGAT    
qPCR ZNF471F GAGATGACGAGTGAGATGAC 194   60
ZNF471R TGACTTCCCATCTGCTTCTC    
GAPDHF CCAGCAAGAGCACAAGAGGAA 114   60
GAPDHR GGTCTACATGGCAACTCAAGG    
MSP ZNF471m44 TTTTGTTTTCGTTTTTTTCGTTC 223   60
ZNF471m6 ACGCGACTAAACCTTCGCG    
ZNF471u44 GTTTTGTTTTTGTTTTTTTTGTTT 228   58
ZNF471u6 AAAAACACAACTAAACCTTCACA    
BGS ZNF471BGS1 GGTTTTTTTTATTTTTTTAGTAGTT 410 41 60
ZNF471BGS4 TCCCACAACTCACTCCAATAA