Skip to main content

Advertisement

Table 2 Primers for GR bisulfite sequencing

From: Region-specific glucocorticoid receptor promoter methylation has both positive and negative prognostic value in patients with estrogen receptor-positive breast cancer

Primer Primer sequence (5′ to 3′) NR3C1 target region [27] # Interrogated CpGs Amplicon size (bp)
A Fwd: ACACTGACGACATGGTTCTACAGGAGGGTGGGTTTTGTTTTGTAAT − 3664 to − 3471 17 193
Rev: TACGGTAGCAGAGACTTGGTCTACCTAACACRCCCTCTAAAAAAAC
C Fwd: ACACTGACGACATGGTTCTACATTTTTTATTTTGYGAGTTYGTGTTTGT − 2754 to − 2633 9 121
Rev: TACGGTAGCAGAGACTTGGTCTCCCRATCCCAACTACTTCRACC
D Fwd: ACACTGACGACATGGTTCTACAGGGTGGAAGGAGAYGTYGTAGT − 2682 to − 2532 16 150
Rev: TACGGTAGCAGAGACTTGGTCTAAACCCCTATTTAAAAAAATCTCCCA
F Fwd: ACACTGACGACATGGTTCTACAATTTTTATTAGTTTYGGGGAGTGGG − 2275 to − 2125 11 150
Rev: TACGGTAGCAGAGACTTGGTCTCCRAAATCAAATTCCTCCCCCTC
L Fwd: ACACTGACGACATGGTTCTACATTTTYGAAGTGATATATTTTAYGTAATT − 3410 to − 3251 17 159
Rev: TACGGTAGCAGAGACTTGGTCTRAAAACTCRCTCTACCCCTTAAC
P Fwd: ACACTGACGACATGGTTCTACAGAAYGTGATAGGGTGAGTAAYGTA − 4062 to − 3910 7 152
Rev: TACGGTAGCAGAGACTTGGTCTAATTACTAACRAAATATAACCCCCCT
T Fwd: ACACTGACGACATGGTTCTACATGAGAATTAAGGAAGGAYGGTTTAG − 4684 to − 4535 12 149
Rev: TACGGTAGCAGAGACTTGGTCTAACATCTTAAAAACRATTAAAAAAACRC
U Fwd: ACACTGACGACATGGTTCTACAGTTAAGTTGTTTATTTYGGTTGYGG − 2440 to − 2304 13 136
Rev: TACGGTAGCAGAGACTTGGTCTTATCTCCRATCCCAACRACACCT
W Fwd: ACACTGACGACATGGTTCTACAGTAGGGGGAGTYGTYGTTAGTTT − 4531 to − 4381 10 150
Rev: TACGGTAGCAGAGACTTGGTCTAAATAACTTTTACRCCCCCACAAATA
  1. Underlined sequences indicate consensus sequences (CS1/CS2) for the addition of sequencing adapters