Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers and amplification conditions used in the first PCR step for all genes in this study. The capital letters in the primer sequences indicate the original C or G. For all genes, the positions refer to the TSS; for M13mp18, the position refers sequence entry X02513.1 (NCBI, GenBank)

From: Selective demethylation of two CpG sites causes postnatal activation of the Dao gene and consequent removal of d-serine within the mouse cerebellum

Gene Amplicons Fw primer Rv primer Amplification conditions
Dao (PR1) + 3/+ 365 TagTTagagaagtTaggYtgYtYaYta agattggtgaRRRaaaaaaggagaga Denature at 95 °C for 2 min; 35 cycles of denaturing at 95 °C for 30 s, annealing at 52 °C for 40 s, and extension at 72 °C for 50 s. Final elongation at 72 °C for 6 m
Dao (PR2) − 234/+ 137 gaaYagYagTgagYtagYtgg caccaRccaRRaatRaaacacaa Denature at 95 °C for 2 min; 38 cycles of denaturing at 95 °C for 30 s, annealing at 54 °C for 40 s, and extension at 72 °C for 50 s. Final elongation at 72 °C for 6 m
Srr + 27/+ 377 GTaTtgggagTaaaagTattTag tttaaactccacaatccaAAcct Denature at 95 °C for 2 min; 35 cycles of denaturing at 95 °C for 30 s, annealing at 57 °C for 40 s, and extension at 72 °C for 50 s. Final elongation at 72 °C for 6 m
Ddo − 63/− 468 gtgtgtttTtgaggaggtgaTaTtTa aActtaccctccattAAtccatAcc Denature at 95 °C for 2 min; 36 cycles of denaturing at 95 °C for 30 s, annealing at 52 °C for 40 s, and extension at 72 °C for 50 s. Final elongation at 72 °C for 6 m
M13mp18 5946/6294 Ggtgaagggtaattagttgttgtt ccaataccaaacttacatacct Denature at 95 °C for 2 min; 33 cycles of denaturing at 95 °C for 30 s, annealing at 57 °C for 40 s, and extension at 72 °C for 50 s. Final elongation at 72 °C for 6 m