Skip to main content

Table 6 Primers sequences for construction of human SUV39H1- pcDNA3.1(+)

From: Suv39h1 promotes facet joint chondrocyte proliferation by targeting miR-15a/Bcl2 in idiopathic scoliosis patients

Primers sequence (5′–3′) CDS length (bp)
F: CGGCTAGCATGGCGGAAAATTTAAAAG 1239
R: CGGGATCCCTAGAAGAGGTATTTGCGG  
  1. Abbreviation: F forward, R reverse, CDS coding sequence