Skip to main content

Advertisement

Table 4 Primers sequences in the promoter region of Human DLEU2

From: Suv39h1 promotes facet joint chondrocyte proliferation by targeting miR-15a/Bcl2 in idiopathic scoliosis patients

Primers Sequence (5′–3′) Length (bp)
Primer 1 F: CAAATACGGGTCCTGCTT 195
  R: GTAAAGTTGTTCCGAGGCTT  
Primer 2 F: TTCTCTTGCTTTCCCGAC 270
  R: GCAGGACCCGTATTTGTTTA  
Primer 3 F: TGCCCTTTGCTCCAAGTA 242
  R: AAGAGGCGGTATTGACAGC  
  1. Abbreviation: F forward, R reverse