Skip to main content

Table 3 Primers sequences for miRNAs

From: Suv39h1 promotes facet joint chondrocyte proliferation by targeting miR-15a/Bcl2 in idiopathic scoliosis patients

miRNAs Primer sequence (5′–3′)  
miR-15a F: TAGCAGCACATAATGGTTTGTG  
miR-16 F: TAGCAGCACGTAAATATTGGCG  
miR-let7d F: AGAGGTAGTAGGTTGCATAGTT  
miR-29b F: TAGCACCATTTGAAATCAGTGTT  
RNU6-B6 F: CGCAAGGATGACACGCAAAT  
  1. Abbreviation: F forward