Skip to main content

Table 3 Selected regions, reference, location, PCR amplification primers, PCR template size, pyrosequencing primers, and number of CpG sites analyzed

From: Maternal obesity influences expression and DNA methylation of the adiponectin and leptin systems in human third-trimester placenta

Gene symbol Ensembl accession number Selected regions Start-End PCR Primer sequences 5′-3′ (bp) PCR product size (bp) Pyrosequencing primer sequences 5′- 3′ (bp) CpG sites included
Leptin (LEP) ENSG00000174697 Chr7: 128,241,050
Chr7: 128,241,412
F: ATTTTTGGGAGGTATTTAAGGG
R: ACATCCCTCCTAACTCAATTT
362 Pyro1: GTTATTTTGAGGGG
Pyro2: TTATAAGAGGGG
#17
Adiponectin (ADIPOQ) ENSG00000181092 Reg1: Chr3: 186783987
Chr3: 186,784,378
F: GGAGGGTTTTAGGTTTTATTTG
R: ACCACCTCAACTACACCTTAAA
391 Pyro1: TGGGGAAGGGTTGGAGGTA
Pyro2: GTATTGTTGGGGG
#21
  Reg2: Chr3: 186801089
Chr3: 186,801,356
F: GTTTTTTTGGAGAGGAGAGAAAG
R: CCRCAAAAAAAACAACTCTC
267 Pyro1: TTTAGGGAGAAAAAGAAGA
Pyro2: GTAGTATTAAGAAGGAG
#12
Leptin receptor (LEPR) ENSG00000116678 Chr1: 65,420,597
Chr1: 65,420,959
F: TTTGGTTTGGGTAGGTTGT
R: AAAAAAACCAAAACTCCCC
288 Pyro1: TTTGGTTTGGGTAGGTTGT
Pyro2: GTTAAAGGTATAT
#13
Adiponectin receptor 1 (ADIPOR1) ENSG00000159346 Chr1: 202,957,739
Chr1: 202,958,035
F: TGGTAATTTAATGYGGTTGTT
R: CCTAACCTCCAAACATCCA
299 Pyro1: TGGTAATTTAATGYGGTTGTT
Pyro2: GTAGTATTTATAGGATTGT
#21
Adiponectin receptor 2 (ADIPOR2) ENSG00000006831 Chr12: 1,691,140
Chr12: 1,691,555
F: TAGYGGTGGTTTTTAAGAAGT
R: AACTAAAACAACTACACCCRAA
379 Pyro1: TAGYGGTGGTTTTTAAGAAGT
Pyro2: AGGTGAGAGTTGAGGGG
#16
  1. F forward, R reverse