Skip to main content

Advertisement

Table 2 RT-PCR primers used in this study

From: The histone methyltransferase DOT1L is required for proper DNA damage response, DNA repair, and modulates chemotherapy responsiveness

Name Sequence Source
h DOT1L For CCACCAACTGCAAACATCAC This study
h DOT1L Rev AGAGGAAATCGCCTCTCTCC This study
HNRNPK For ATCCGCCCCTGAACGCCCAT [36]
HNRNPK Rev ACATACCGCTCGGGGCCACT [36]