Skip to main content

Advertisement

Table 1 Primers used for MSP-PCR and real-time PCR

From: The polyphenol quercetin induces cell death in leukemia by targeting epigenetic regulators of pro-apoptotic genes

Genes Primer sense (5′–3′) Primer antisense (5′–3′)
BCL2L11 M AGTATTTTCGGTAAATAATGGGGT GAATAAATCAAAAACTCCCAACG
U GTATTTTTGGTAAATAATGGGGTTG CAAATAAATCAAAAACTCCCAACA
DAPK1 M GGATAGTCGGATCGAGTTAACGTC CCCTCCCAAACGCCGA
U GGAGGATAGTTGGATTGAGTTAATGTT CAAATCCCTCCCAAACACCAA
APAF1 CCCAGAGGCTTCCACTTAATATTG CAAACATCATCCAAGATCAAGAGAGA
BAX TGAGTACTTCACCAAGATTGCCA AGTCAGGCCATGCTGGTAGAC
BCL2L11 TGTCTGACTCTCTCCGGACTG TGACCACATCGAGCTTTAGCCAGTCA
BNIP3 CCAGAACATCATCCCTGCAT TTCCAGTAGGGTCTCGACTTG
BNIP3L CTCAGGATCCACAGCAAACA CCAGACTGGACTCTGCCTTC
DNMT1 CCATCAGGCATTCTACCA CGTTCTCCTTGTCTTCTCT
DNMT3a TATTCATGAGCGCACAAGAGAGC GGGTGTTCCAGGGTAACATTGAG
STAT3 CACCTTGGATTGAGAGTCAAGAC AGGAATCGGCTATATTGCTGGT
  1. M methylated, U unmethylated