Skip to main content

Table 2 Specific genomic information of CpG sites shown to be associated with the rs174570

From: FADS1-FADS2 genetic polymorphisms are associated with fatty acid metabolism through changes in DNA methylation and gene expression

Region CpG site Location Sequence
Region1 CpG_9 Chr11: 61814879 GAAAGACCCGCAAGAAGGGA [CG]GAAGTCTCATAGCCCTGAGA
CpG_10 Chr11: 61814891 AAGGGACTTATTGAAAGACC [CG]CAAGAAGGGACGGAAGTCTC
CpG_11 Chr11: 61814944 CGTAGGGAAGTCTTCCTCTT [CG]TGGTTTTTGGAGAACCCTAG
CpG_12 Chr11: 61814968 AACGCAGAAGTGCCCCAGTT [CG]GACGTAGGGAAGTCTTCCTC
Region2 CpG_1 Chr11: 61820815 CTTTGCCTCCTGGGTTCAAG [CG]ATTCTCCTGCCTCACCCCCA
Region3 CpG_2 Chr11: 61825572 AGGTTGCAGTGAGCTGAGAT [CG]CACCACTGCACTCCAGCCTG
CpG_3 Chr11: 61825596 CCACTGCACTCCAGCCTGGG [CG]ACAGAGTGAGACCCTGTCTC
CpG_4 Chr11: 61825658 GAAAAAGCCCTTTGGGAGGC [CG]AGGCAGGTGGATCACGAGGT
  1. Region1, region2, and region3 indicate the selected regions used for DNA methylation analysis; sequence indicates 20 bp upstream and downstream of the CpG site in the genome (GRCh38/hg38 Assembly). Chr chromosome