Skip to main content

Advertisement

Table 4 Bisulfite pyrosequencing and real-time PCR primers

From: Methylation of BRCA1 and MGMT genes in white blood cells are transmitted from mothers to daughters

  Primers sequences No. of CpG sites Annealing temp
F1 R1Bio Sequencing GGTATTGGATGTTTTTTTTTATAAGATTAT CCAATCCCCCACTCTTTC ATTATAGTTTTTAAGGAATATTGTG 3 56
F2 R2 Sequencing GAAAGAGTGGGGGATTGGGATT AAAATACCTACCCTCTAACCTCTACT ACCTCTACTCTTCCA 4 60
F3 R3 Bio Sequencing AGGGTAGGTATTTTATGGTAAATTTAGGT TATCTAAAAAACCCCACAACCTATCC ATGGTAAATTTAGGTAGAATTTT 5 60
F4 R4Bio Sequencing AGATTGGGTGGTTAATTTAGAGT TCTAAAAAACCCCACAACCTATCC GGAAAAGAGAGGGAATTATAGATAA 6 58
F5 R5 Bio Sequencing GGGGTAGATTGGGTGGTTAA TTATCTAAAAAACCCCACAACCTATC GAGAGGTTGTTGTTTAG 5 58
BRCA1 F 5′–TGTAGGCTCCTTTTGGTTATATCATTC–3′ R 5′–CATGCTGAAACT TCTCAACCAGAA–3′ 59 °C
β- Actin F 5′–TCC CTG GAG AAG AGC TAC GA–3′ R 5′–TGA AGG TAG TTT CGT GGA TGC–3′ 59 °C
  1. F forward, R reverse