Skip to main content

Table 4 Bisulfite pyrosequencing and real-time PCR primers

From: Methylation of BRCA1 and MGMT genes in white blood cells are transmitted from mothers to daughters

  Primers sequences No. of CpG sites Annealing temp
F1
R1Bio
Sequencing
GGTATTGGATGTTTTTTTTTATAAGATTAT
CCAATCCCCCACTCTTTC
ATTATAGTTTTTAAGGAATATTGTG
3 56
F2
R2
Sequencing
GAAAGAGTGGGGGATTGGGATT
AAAATACCTACCCTCTAACCTCTACT
ACCTCTACTCTTCCA
4 60
F3
R3 Bio
Sequencing
AGGGTAGGTATTTTATGGTAAATTTAGGT
TATCTAAAAAACCCCACAACCTATCC
ATGGTAAATTTAGGTAGAATTTT
5 60
F4
R4Bio
Sequencing
AGATTGGGTGGTTAATTTAGAGT
TCTAAAAAACCCCACAACCTATCC
GGAAAAGAGAGGGAATTATAGATAA
6 58
F5
R5 Bio
Sequencing
GGGGTAGATTGGGTGGTTAA
TTATCTAAAAAACCCCACAACCTATC
GAGAGGTTGTTGTTTAG
5 58
BRCA1 F 5′–TGTAGGCTCCTTTTGGTTATATCATTC–3′
R 5′–CATGCTGAAACT TCTCAACCAGAA–3′
59 °C
β- Actin F 5′–TCC CTG GAG AAG AGC TAC GA–3′
R 5′–TGA AGG TAG TTT CGT GGA TGC–3′
59 °C
  1. F forward, R reverse