Skip to main content

Table 3 Primer pairs for real-time PCR

From: Vitamin C increases 5-hydroxymethylcytosine level and inhibits the growth of bladder cancer

Genes Sequence (5′ to 3′)
GAPDH Sense GGTGAAGGTCGGAGTCAACG
Antisense TGGGTGGAATCATATTGGAACA
TET1 Sense AATGGAAGCACTGTGGTTTG
Antisense ACATGGAGCTGCTCATCTTG
TET2 Sense AATGGCAGCACATTGGTATG
Antisense AGCTTCCACACTCCCAAACT
TET3 Sense GAGGAGCGGTATGGAGAGAA
Antisense AGTAGCTTCTCCTCCAGCGT
SVCT1 Sense TCATCCTCCTCTCCCAGTACCT
Antisense AGAGCAGCCACACGGTCAT
SVCT2 Sense TCTTTGTGCTTGGATTTTCGAT
Antisense ACGTTCAACACTTGATCGATTC
IDH1 Sense TCCGTCACTTGGTGTGTAGG
Antisense GGCTTGTGAGTGGATGGGTA
IDH2 Sense TGAACTGCCAGATAATACGGG
Antisense CTGACAGCCCCCACCTC
L2HGDH Sense TCAAAAATTCATCCCTGAAATTACT
Antisense CTACCAGATTTCCATCTCTATCCAG