Skip to main content

Table 1 List of primers used in this study

From: The new 6q27 tumor suppressor DACT2, frequently silenced by CpG methylation, sensitizes nasopharyngeal cancer cells to paclitaxel and 5-FU toxicity via β-catenin/Cdc25c signaling and G2/M arrest

PCR Primer Sequence (5′-3′) Product size (bp) PCR cycles Annealing temperature (°C)
RT-PCR DACT2F AGCCGTGGGGCACATTCTG 173 32 55
DACT2R CCAGGTCCTGCCGATACTTG   
β-actinF TCCTGTGGCATCCACGAAACT 315 23 55
β-actinR GAAGCATTTGCGGTGGACGAT   
qRT-PCR CyclinB1F TCTGGATAATGGTGAATGGACA 157   60
CyclinB1R CGATGTGGCATACTTGTTCTTG   
MMP2F CATACAGGATCATTGGCTACACAC 99 60
MMP2R GCAGTGGGGTCACATCGCT   
MMP9F CCTGGAGACCTGAGAACCAATC 79 60
MMP9R CCACCCGAGTGTAACCATAGC   
Cdc25cF GATGTCCCTAGAACTCCAGTG 120 60
Cdc25cR AGTTATCTCCCCACTGCTAAGA   
β-actinF1 GTCTTCCCCTCCATCGTG 113 60
β-actinR1 AGGGTGAGGATGCCTCTCTT   
MSP DACT2m1 CGTGTAGATTTCGTTTTTCGC 200 40 60
DACT2m2 CCGAAAATCCGCCCGACG   
DACT2u1 TGTGTGTAGATTTTGTTTTTTGT 203 40 58
DACT2U2 CCCCAAAAATCCACCCAACA   
BGS DACT2BGS1 GGTTATAGATTTTAGTTTATTTTGG 249 40 60
DACT2BGS2 CTACAACTCCTACAACCCC