Skip to main content

Table 1 Primers used to analyze the methylation status

From: Effect of a diet containing folate and hazelnut oil capsule on the methylation level of the ADRB3 gene, lipid profile and oxidative stress in overweight or obese women

Gene Primers Annealing temperature
ADRB3 F 5′CCTTCCTTCTTTCCCTACCG3′ 64 °C
  R 5′TGGTCTGGAGTCTCGGAGTC3′  
  1. F forward primer, R reverse primer