Skip to main content

Advertisement

Table 1 The list of PCR primers

From: The effect of Nipped-B-like (Nipbl) haploinsufficiency on genome-wide cohesin binding and target gene expression: modeling Cornelia de Lange syndrome

Unique regions ChIP primers
 pax2-F CTGGCACTGACATCTTGTGG
 pax2-R TGGGACCTGTAGTCCTGACC
 anapc13-F TCCTAAGCCGTCCTGTAGTCC
 anapc13-R GGGTGTCCATCATCTGAGTCC
 alox8-F GTATGAGGTGGGCCTGAGTG
 alox8-R AAGCCCTGCCTAAATGTGTG
 ebf1-F AACTGAGCCTTAGGGGAAGC
 ebf1-R TCAGGGTTCAATCTCCAAGG
 cebpb-F AGAGTTCTGCTTCCCAGGAGT
 cebpb-R GGAAACAGATCGTTCCTCCA
 fez1-F GAGGGTGGGACGTATTTCAGT
 fez1-R CAGCCTTCTTTCCCTCACAA
 pcdhb22-F GCAGTAATGCCAGCAATGG
 pcdhb22-R TCCAGTTGGTTGGGTTTCAT
RT-qPCR primers  
 Rnh1-F (Housing keeping gene) TCCAGTGTGAGCAGCTGAG
 Rnh1-R (Housing keeping gene) TGCAGGCACTGAAGCACCA
 Nipbl-F AGTCCATATGCCCCACAGAG
 Nipbl-R ACCGGCAACAATAGGACTTG
 Rad21-F AGCCAAGAGGAAGAGGAAGC
 Rad21-R AGCCAGGTCCAGAGTCGTAA
 Cebpb-F GCGGGGTTGTTGATGTTT
 Cebpb-R ATGCTCGAAACGGAAAAGG
 Cebpd-F ACAGGTGGGCAGTGGAGTAA
 Cebpd-R GTGGCACTGTCACCCATACA
 Ebf1-F GCGAGAATCTCCTTCAAGACTTC
 Ebf1-R ACCTACTTGCCTTTGTGGGTT
 Il6-F TAGTCCTTCCTACCCCAATTTCC
 Il6-R TTGGTCCTTAGCCACTCCTTC
 Avpr1a-F TGGTGGCCGTGCTGGGTAATAG
 Avpr1a-R GCGGAAGCGGTAGGTGATGTC
 Lpar1-F ATTTCACAGCCCCAGTTCAC
 Lpar1-R CACCAGCTTGCTCACTGTGT
 Adm-F TATCAGAGCATCGCCACAGA
 Adm-R TTAGCGCCCACTTATTCCAC
Cebpb 3C primers  
 cebpb-promoter ACTCCGAATCCTCCATCCTT
 cebpb-region-b CCTGCCCTGTATCAAAGCAT
 cebpb-region-a CTGCCCAAATCAGTGAGGTT
 cebpb-region-c CCTCTGTGAGGTCTGGTCGT
 cebpb-promoter-R GGTGGCTGCGTTAGACAGTA
 cebpb-region-a-R GTTGTATCCCAAGCCAGCTC
 cebpb-region-b-R CTCCCCACTCTGTTCAGGAC
 cebpb-region-c-R TAACAGCAGGGATGGGTTCT