Skip to main content

Table 1 Primers used

From: Histone deacetylase inhibitors potentiate photodynamic therapy in colon cancer cells marked by chromatin-mediated epigenetic regulation of CDKN1A

Method Gene Primers (5′-to-3′ sequence)
qRT-PCR HDAC1 fw CCAAGTACCACAGCGATGAC
rev CTGGACAGTCCTCACCAACG
HDAC3 fw TTGAGTTCTGCTCGCGTTACA
rev CCCAGTTAATGGCAATATCACAGAT
HDAC6 fw TGGCTATTGCATGTTCAACCA
rev GTCGAAGGTGAACTGTGTTCCT
CDKN1A fw GACACCACTGGAGGGTGACT
rev CCACATGGTCTTCCTCTGCT
DNMT1 fw GATGTGGCGTCTGTGAGGT
rev CCTTGCAGGCTTTACATTTCC
DNMT3A fw CCTGAAGCCTCAAGAGCAGT
rev TGGTGTCCTTCTGTTCTTTGC
EZH2 fw ACTGGCGAAGAGCTGTTTTT
rev TTCGATGCCGACATACTTCA
GAPDH fw AACGGGAAGCTTGTCATCAA
rev TGGACTCCACGACGTACTCA
Pyrosequencing CDKN1A enhancer fw AGGAGGGAAGTGTTTTTTTGTAGTA
rev biotinylated-ACAACTACTCACACCTCAACTAAC
sequencing primer:
fw primer was used as sequencing primer in addition to:
S1 GGGTAGTTAGGAGT
S2 TTTGGTTTTTTTGAG
Genomic coordinates (hg38) of spanned region: CHRO STRAND 6 +, START 36678496, END 36678730
  CDKN1A promoter fw GGTTGGAATAGTTTGTTTTTAAGGA
rev biotinylated-AAATAAAAAAAACCCTTACCCTTC
sequencing primer:
fw primer was used as sequencing primer in addition to:
S GCGCGTTGTAGGG
Genomic coordinates (hg38) of spanned region: CHRO STRAND 6 +, START 36679579, END 36679743
  CDKN1A gene body fw GGGTTTTGGTTTGTTTAAGTTTTATT
rev biotinylated-CCACATAATCTTCCTCTACTATCC
sequencing primer:
fw primer was used as sequencing primer
Genomic coordinates (hg38) of spanned region: CHRO STRAND 6 +, START 36684308, END 36684436
ChIP CDKN1A enhancer fw GAAGCATGTGACAATCAACAACT
rev AAGCATCTTGAGGCCAGAAT
Genomic coordinates (hg38) of spanned region: CHRO STRAND 6 +, START 36678037, END 36678143
CDKN1A promoter fw ACTCCAGAAGCCCTCTCC
rev GGCTTCCTTGGGAACAAACT
Genomic coordinates (hg38) of spanned region: CHRO STRAND 6 +, START 36679513, END 36679607
CDKN1A gene body fw GAGACCCTCTGGTAGGAAGA
rev GAGATACAAGGAAGGCCCTG
Genomic coordinates (hg38) of spanned region: CHRO STRAND 6 +, START 36683986, END 36684088