Skip to main content

Table 2 Primer sequences for pyrosequencing

From: Ultraviolet-B induces ERCC6 repression in lens epithelium cells of age-related nuclear cataract through coordinated DNA hypermethylation and histone deacetylation

Forward primer (5′-3′) Reverse primer (5′-3′) Sequence primer (3′-5′) Product size (bp)
Biotin—GYGGGGAAGGGAGGAGTTTTA CCCRTTCTCCRTCCCTTACCT CCTACTTTAAAATTCAAAACCA 160
   TTCTCCTTCCCTTACCTCC  
Biotin—TGTGGAGTYGYGGAGGTAAGA AAAACTTTATACCCRACATAAAAAA CTTTATACCCTACATAAAAAAC 97
Biotin—TGTGGAGTYGYGGAGGTAAGGA ACTCTACCRTTAAAACRACACTCACCC ACATAATAACTAACTTCCTAACC 218