Skip to main content

Advertisement

Table 2 Primers for quantitative real-time RT-PCR

From: Epigenetic reprogramming of melanoma cells by vitamin C treatment

Gene Forwards (5’ → 3’) Reverse (5’ → 3’)
TET1 AATGGAAGCACTGTGGTTTG ACATGGAGCTGCTCATCTTG
TET2 AATGGCAGCACATTGGTATG AGCTTCCACACTCCCAAACT
TET3 GAGGAGCGGTATGGAGAGAA AGTAGCTTCTCCTCCAGCGT
SVCT1 TCATCCTCCTCTCCCAGTACCT AGAGCAGCCACACGGTCAT
SVCT2 TCTTTGTGCTTGGATTTTCGAT ACGTTCAACACTTGATCGATTC
ARGHAP30 GTGCCCCAGGTGCTAAAGAG CTTGGAGGTAAACATCCCGAC
TRIM63 GCTTTGAGAACATGGACTTCTTT CTTCTGTGGACTCTTCCTCTTC
PTPN7 GGGAGGTCACCCTACACTTTC TGGTCTTGTATCGGTCCTTGG
SOCS3 GGAGACTTCGATTCGGGACC GAAACTTGCTGTGGGTGACC
FAP CAAAGGCTGGAGCTAAGAATCC ACTGCAAACATACTCGTTCATCA
GPRIN3 ATGGGGACTGTACCTGACCC GGTGGTCTCATGCTCACAAAC
TIMP3 CGGTATCACCTGGGTTG GTAGCCAGGGTAACCGAAA
MAGEA4 AGGAGCACCAAGGAGAAGAT GCTTGCAGTGCTGACTCTT
SERPINE4 CTCGCCATGGTGATGAGATAC CCTCACACTGGAACACATCTT
SLITRK2 CCTGGAAGCAGCGTCTTATT CCTACTAAATCCTGCCCATCTC