Skip to main content

Table 6 Sequences of primers used for pyrosequencing validation

From: Two independent epigenetic biomarkers predict survival in neuroblastoma

Genes Amplification primers Sequencing primers
Name Sequence
CTSZ Forward GTTGGGGYGTAGGTGGGTAT GTAGTTTTGGGGGGA
Reverse [Btn]CACAAACATCAAAACTCACCCTAAATAT
DUSP2 Forward TTGAGTGGTTTGGGATAGGTTAA GGGATAGGTTAAAGGGT
Reverse [Btn]AAAACRCAATCTAAACTAACCTAAAAACTT
CCND1 Forward [Btn]GGGYGGTTGGGTTTGTGTATTT CATATTTATCTTTTTATCTTCTACT
Reverse ACCACCCTACCCTAATTCT
ECRG4 Forward ATTTTGGGTAAGGAGGGTTAG GGGTAAAAGGGTTGT
Reverse [Btn]TACCATTTACCTCCTCTAAATTACCA
RUNX3 Forward [Btn]GGTTTTGGGAATTAGAGTTTAAGG AAAAAAAAATCAATTCCAACT
Reverse ACTAACATAACCCCRAAATAATACATCCTA
TP73 Forward AGTTAGTTGATAGAATTAAGGGAGATG ATGGGAAAAGYGAAAATGTTAATAA
Reverse [Btn]ATCTACACACRCCAAAAAACTAATATCCC
LCCR4 Forward TGGAAAGAGGAGTTTTTAGTTTATTTAAG AAATTTTAGGYGATGGTGAATTA
Reverse [Btn]ATTACCTACCACAAAAACTTCATAATAT
MAGEA2 Forward GATTTGYGTATTGGAGGTTAGAGGATA GTAAGAYGTYGAGGGAGGATTGA
Reverse [Btn]TAAAAAATCTTCCCCTACAAAATAATCCA
MGMT Forward TTTTTGGAGAGYGGTTGAGTTAGGT AGGTTATYGGTGATTGTAGTT
Reverse [Btn]CCAAACCAACAAAAACCCTATCA
NNAT Forward TGTAGGTTAGGGATTGGGGAGAA TTAAAGTAAAATTTAAAAGTAAGT
Reverse [Btn]TCCATCTTAACCCCCTTCCAA
TSPAN32 Forward GAGGTTTATAAAGTTTTTTTTTGGAGG GAGGTTTTAYGTGAGTGTGA
Reverse [Btn]CACCCTTTAAAATATCCTATAACAACTT
HPN Forward ATGAAATAAAGATTTTTGGATTTGATGTAT GTGAGTTTYGTTATTTTTTTTTTAT
Reverse [Btn]TAAATAACTTCACCTATAAACCCTCAAAT
JAK2 Forward [Btn]TTTTTTAGATAGTTATGGGATTGGTTTAT AATAAAAACRACAAAACAACAAACA
Reverse ACACTCCTTACCCTACTAAATTATATT
PAX 8 Forward GTGATTTAGGAGGATTTAGAGAATTTTATT ATTTTTTTGTATTTAGTTAGTTAA
Reverse [Btn]CTCTCCTCCTTCTAAAATTTATTCC
TDGF1 Forward ATTGGGGTTTGTTGTTGAAGAA TTTATTTTTTTTTTAAATTGTTATT
Reverse [Btn]AAACAACCAAAAAAAAACATTCATCTCC
RB1 Forward [Btn]TTGGGGTTGGTTTATTTATTTAGTTTTG TTACCCCTCCTCCCC
Reverse AACRAAAAACCCTTACCCCTCCTC