Restitution of gene expression and histone acetylation signatures altered by hepatitis B virus through antiviral microRNA-like molecules in nontransformed murine hepatocytes

Table 2 Primer pairs used for the detection of murine SIRT1-7 mRNAs by quantitative real-time polymerase chain reaction (qPCR)

Name	Forward primer	Reverse primer	Amplicon size
mmuSIRT1	Ggccgcggataggtccata	acaatctgccacagcgtcat	136 bp
mmuSIRT2	Gtgcaggaggctcaggatt	tgtagcgtgtcactccttcg	163 bp
mmuSIRT3	Cgctaaacttctcccgggtt	cctgtaacactagtcctcgcc	156 bp
mmuSIRT4	Aacccgactgtttagccgtt	ccgctcattcttattctgtctgg	190 bp
mmuSIRT5	Caccgacagattcaggtttca	agtgccctgctttagcactc	155 bp
mmuSIRT6	Cacaaaacatgaccgccagg	ctgcaccattgagatgcacg	191 bp
mmuSIRT7	Tctacaaccggtggcaggat	cctcctaggatagggggagc	160 bp

ISSN: 1868-7083