Skip to main content


Table 2 Primer pairs used for the detection of murine SIRT1-7 mRNAs by quantitative real-time polymerase chain reaction (qPCR)

From: Restitution of gene expression and histone acetylation signatures altered by hepatitis B virus through antiviral microRNA-like molecules in nontransformed murine hepatocytes

Name Forward primer Reverse primer Amplicon size
mmuSIRT1 Ggccgcggataggtccata acaatctgccacagcgtcat 136 bp
mmuSIRT2 Gtgcaggaggctcaggatt tgtagcgtgtcactccttcg 163 bp
mmuSIRT3 Cgctaaacttctcccgggtt cctgtaacactagtcctcgcc 156 bp
mmuSIRT4 Aacccgactgtttagccgtt ccgctcattcttattctgtctgg 190 bp
mmuSIRT5 Caccgacagattcaggtttca agtgccctgctttagcactc 155 bp
mmuSIRT6 Cacaaaacatgaccgccagg ctgcaccattgagatgcacg 191 bp
mmuSIRT7 Tctacaaccggtggcaggat cctcctaggatagggggagc 160 bp