Skip to main content

Table 1 List of sequence and product length of the real-time PCR primers used in this study

From: Expression profiling of DNA methylation-mediated epigenetic gene-silencing factors in breast cancer

Gene Primer sequence Product length (bp)
DNMT1 F 5′-GGCTGAGATGAGGCAAAAAG -3′ 112
R 5′-ACCAACTCGGTACAGGATGC -3′
DNMT3A F 5′-TATTGATGAGCGCACAAGAGAGC -3′ 111
R 5′-GGGTGTTCCAGGGTAACATTGAG -3′
DNMT3B F 5′-AATGTGAATCCAGCCAGGAAAGGC -3′ 191
R 5′-ACTGGATTACACTCCAGGAACCGT -3′
MeCP2 F 5′-TGACCGGGGACCCATGTAT -3′ 145
R 5′- CTCCACTTTAGAGCGAAAGGC -3′
MBD1 F 5′- CCTGGGTGCTGTGAGAACTGT -3′ 107
R 5′- TTGAAGGCAATTCTCTGTGCTC -3′
MBD2 F 5′- AGGTAGCAATGATGAGACCCTTTTA -3′ 116
R 5′- TAAGCCAAACAGCAGGGTTCTT -3′
MBD3 F 5′- CCGCTCTCCTTCAGTAAATGTAAC -3′ 101
R 5′- GGCTGGAGTTTGGTTTTCAGAA -3′
MBD4 F 5′- AGACCCGCCGAATGACCT -3′ 144
R 5′- GCACCAAACTGAGCAGAAGCG -3′
β-ACTIN F 5′- CTGGAACGGTGAAGGTGACA -3′ 140
R 5′- AAGGGACTTCCTGTAACAACGCA -3′