Skip to main content

Table 2 Overview of the potential nonsynonymous Sirt1 SNPsin silico and analyzed

From: Sirtuin1 single nucleotide polymorphism (A2191G) is a diagnostic marker for vibration-induced white finger disease

dbSNP [Assay ID] Region 5Near Seq 30 bp Allele 3Near Seq 30 bp Codon position Protein residue Amino acid position
rs1063114 Exon 8 agactgtgatgtcataattaatgaattgtg A/T cataggttaggtggtgaatatgccaaactt 3 Ter/Cys [*/C] 490
[C_9638456_10] ancestral allele: T
rs1063111 Exon 8 ttgatgtagagcttcttggagactgtgatg A/T cataattaatgaattgtgtcataggttagg 2 Asp/Val [D/V] 484
[C_9638445_10] ancestral allele: T
rs1063112 Exon 8 atgtagagcttcttggagactgtgatgtca C/T aattaatgaattgtgtcataggttaggtgg 2 Thr/Ile 485
[SIRT1-A485] ancestral allele: T [T/I]
rs35224060 Exon 9 ggagatgatcaagaggcaattaatgaagct A/G tatctgtgaaacaggaagtaacagacatga 1 Ile/Val 731
[C_25611590_10] ancestral allele: n.a. [I/V]
rs3740051 promoter agccgcctccttttgcctctcttcctactt A/G ttaacaaaacagaacgactatccaacgtat - - -
[C_27471644_10]
ancestral allele: A
rs2236319 Intron 4 agggatgtcagtctgatggagaaattgggt A/G tttgttagatctttatgagaaactggaaac - - -  
[C_15954063_10]    ancestral allele: A     
  1. bp: base pair; dbSNP: Database of Single Nucleotide Polymorphisms.