Skip to main content

Table 5 Primer sequences and annealing temperature.

From: Analysis of hypermethylation and expression profiles of APC and ATM genes in patients with oral squamous cell carcinoma

Genes Sequences Annealing
temperature
APC M F:GAACCAAAACGCTCCCCAT
R:TTATATGTCGGTTACGTGCGTTTATAT
61
APC U F:AAACCAAAACACTCCCCATTC
R:AGTTATATGTTGGTTATGTGTGTTTAT
56
ATM M F:GGAGTTCGAGTCGAAGGG
R:CTACCTACTCCCGCTTCCGA
65
ATM U F:GTTTTGGAGTTTGAGTTGAAGGGT
R:AACTACCTACTCCCACTTCCAA
60
GAPDH (Real Time-PCR) F: CCACTCCTCCACCTTTGAC
R: ACCCTGTTGCTGTAGCCA
60
APC(Real Time-PCR) F:CTTCAAAATTACCTCCAC R:CTCCTCTAACTCCTTCTC 60
ATM(Real Time-PCR) F:CAGGGTAGTTTAGTTGAG GTTGACAG R:CTATACTGGTGGTCAGTGCCAAAGT 60